Molecular Characterization and Expression Analysis of NAC Family

ORIGINAL PAPER

Molecular Characterization and Expression Analysis of NAC Family Transcription Factors in Tomato

Xiaohong Kou&Shuang Wang&Mengshi Wu&

Runzi Guo&Zhaohui Xue&Nan Meng&Xiaomin Tao&

Mimi Chen&Yifei Zhang

#Springer Science+Business Media New York2013

Abstract The NAC family is considered one of the largest plant-specific transcription factors families,and functions in diverse and vital physiological processes during development. In the present study,we performed a complete bioinformatics analysis of the NAC family transcription factors in tomato,and annotated the non-redundant SlNAC1-74proteins into12sub-groups.Six NAC genes from tomato,which were designated SNAC4–SNAC9,were studied instensively.The expression anal-ysis indicated that each SNAC gene exhibited a specific expres-sion pattern in the tissues examined.SNAC4and SNAC6were most highly expressed in the stems and leaves,whereas the expression levels of SNAC5,SNAC8and SNAC9were higher in young leaves and old leaves,respectively.In addition,the expression patterns of SNAC genes were characterized during the development of tomato fruits.All of the genes were further investigated to determine their responsiveness to hormones,and a coordinated expression was observed.The expression of the SNAC gene transcripts was induced by ABA,SA and short-time ethylene treatment,whereas their transcription was inhibited by GA,6-BA and IAA.Our present study provides a useful refer-ence for future investigations of NAC genes in tomato and other fleshy fruits.Keywords NAC.Transcription factor.Tomato. Development.Hormones

Introduction

Transcription factors(TFs)are proteins that interact with DNA promoters and are involved in gene expression and regulation.Various plant TFs,which contain various function-al domains,such as MYB,DREB and NAC,have been well studied.The NAC gene family name is an acronym derived from the first three identified genes containing this domain: NAM from Petunia and,ATAF1/2and CUC2from Arabidopsis(Souer et al.1996;Aida et al.1997).The NAC family members are characterized with a highly conserved NAC domain region at the N-terminal as a functional domain, which can be further divided into five subdomains(A-E).The C-terminal region is highly variable in sequence composition and length and,plays a vital role as a transcriptional activator or repressor(Xie et al.2000;Ooka et al.2003;Tran et al. 2004;Kim et al.2007a).

The plant-specific NAC family refers to proteins contain-ing the NAC domain,and is one of the largest transcription factor families in plants.A continuously increasing number of NAC genes have been identified and studied in different plants.There are105and140NAC or NAC-like genes in Arabidopsis and rice,respectively,and these can be further classified into18subfamilies(Ooka et al.2003;Fang et al. 2008).The specific subfamilies are composed of multi-functional proteins involved in various plant biological pro-cesses related to growth and development,including cell division(Kim et al.2006),seed and embryo development (Duval et al.2002;Sperotto2009),the formation of lateral roots and cotyledons(Aida et al.1997;Weir et al.2004;

He Xiaohong Kou and Shuang Wang made equal contributions to this work.

Electronic supplementary material The online version of this article

(doi:10.1007/s11105-013-0655-3)contains supplementary material,

which is available to authorized users.

X.Kou

:S.Wang(*):M.Wu:R.Guo:Z.Xue(*):N.Meng:

X.Tao

:M.Chen:Y.Zhang

School of Chemical Engineering and Technology,Tianjin University,

Tianjin300072,People’s Republic of China

e-mail:wangshuang19890720@https://www.360docs.net/doc/0515045632.html,

e-mail:zhhxue@https://www.360docs.net/doc/0515045632.html,

Plant Mol Biol Rep

DOI10.1007/s11105-013-0655-3

et al.2005),the maintenance of shoot apical meristems(Souer et al.1996;Aida et al.1997;Kim et al.2007b;Mao et al. 2007),organ growth and senescence(Sablowski and Meyerowitz1998;Guo and Gan2006;Liu et al.2009;Kou et al.2012a,b),the synthesis of secondary walls(Zhong et al. 2007b;Ko et al.2007)and plant nutrition regulation(Uauy et al.2006;Ogo et al.2008).

Transcriptome studies have shown that many NAC tran-scription factors are involved in the response to abiotic stress and hormonal treatments.Furthermore,some of the NAC transcription factors have been reported to be potential genes for the engineering of stress resistance during the plant life-cycle.Interestingly,phylogenetic analysis shows that most of the stress-responsive NACs belong to the ATAF and AtNAC3 subfamilies.The SNAC1and SNAC2genes in rice are in-duced by cold,salinity,drought,and ABA(abscisic acid) treatment,and the transgenic plants that overexpress these genes demonstrate increased tolerance against cold,salt,and drought(Hu et al.2006;Hu et al.2008).SNAC2and OsNAC10can improve the expression of some related genes under stress conditions(Jeong et al.2010).The ANAC19,55 and72genes in Arabidopsis are inducible by drought,salt and ABA,and have been confirmed to be positive regulators in the ABA signaling pathway and stress tolerance(Tran et al. 2004;Fujita et al.2004).NAC genes are also involved in the defense against biotic stress and are up-regulated under con-ditions of pathogen infection and attack.It has been shown that OsNAC19in rice is elevated by Magnaporthe grisea infection(Lin et al.2007).

Tomato is one of the most popular fleshy fruits in the world and exhibits a wealth of nutrition.The abundant genetic re-sources available make tomato an essential model system for the study of the development,ripening and senescence of fleshy fruits(Alexander and Grierson2002;Giovannoni2004;Klee and Giovannoni2011).Most available research focuses mainly on model species,such as Arabidopsis and rice,and the char-acterization of NAC genes in tomato is still rudimentary.An NAC gene,SlNAC3,isolated from a tomato flower cDNA library was recently reported(Han et al.2012).A digital anal-ysis revealed that SlNAC3demonstrates a tissue-specific ex-pression pattern and is inhibited by drought,salt stress and ABA treatment.The completion of the high-quality sequencing of the tomato genome has provided an excellent opportunity for the genome-wide analysis of NAC family genes(International Tomato Genome Sequencing Project2012).

In the present study,74SlNAC genes were identified and classified according to their phylogeny.The molecular fea-tures of the genes and their encoded proteins were also ana-lyzed.We also studied the developmental expression patterns of six genes,namely SNAC4-9,which belong to the NAP and AtNAC3subgroups in tomato.Through molecular cloning and sequence characterization,we found that all six genes share a similar genomic organization and high sequence similarities,especially within the NAC domains.A tissue-specific expression analysis showed that these genes exhibit different expression patterns,particularly during fruit devel-opment.We further investigated the responses of the genes to hormone treatments.The present study constitutes the first systematic study of NAC genes in tomato,and the information generated suggests that the NAC genes may regulate tomato growth and fruit development.

Materials and Methods

Plant Growth and Treatments

Plants of tomato cultivar AC were used throughout the exper-iments described in this manuscript.The plants were field-grown under normal conditions at Tianjin University.

The vegetable tissues,such as leaves,stems and roots,were collected from seedlings starting30days after flowering (DAF),and the open flowers were sampled and prepared for tissue-specific expression assays.The developing fruits from 35to55DAF,at the green mature,breaker,pink,and red ripe stages,were collected,divided into the pericarp,radial peri-carp,and columella,frozen immediately in liquid nitrogen and stored at?80°C until further use.

For exogenou hormones treatments,10g tomato fruit tissue discs(diameter of10mm)at the green mature stage were immersed in50ml vials containing0.1mM ABA (abscisic Acid),0.1mM IAA(indole Acetic Acid),0.1mM GA(gibberellic Acid),0.1mM6-BA(6-benzylaminopurine) and1mM SA(salicylic Acid),respectively.The control group discs were treated with the buffer solution(50mmol/L citric acid,100mmol/L sorbitol and0.33mmol/L chlorampheni-col).To evaluate the effects of ethylene treatment,tomato fruits were placed in vials,which were injected with50μL of2%(v/v)ethylene(air as a control)to obtain a final concentration of100μL/L.The hormone treatments lasted 0,2,4,6,8,10,12,24,or48h at23°C.All of the samples were rinsed,frozen in liquid nitrogen and stored at?80°C for further use.Three biological replications were performed for each treatment of sampling time point.

Collection of SlNAC Gene Family Members

We selected10reported NAC protein sequences from five subgroups of the NAC family as queries for a BLASTP search in the tomato SOL database(https://www.360docs.net/doc/0515045632.html,/),using an e-value of1e-10.The GenBank accession numbers of the repre-sentative genes are the followings:A TAF1/2(X74755/X74766), AtNAM/NAP/AtNAC2(AF123311/AJ222713/AB049071), CUC1/2/3(AB049069/AB002560/AF543194),TIP (AF281062),and AtNAC072(At4g27410).Conserved Domain Database(CDD)search in NCBI(http://www.ncbi.

Plant Mol Biol Rep

https://www.360docs.net/doc/0515045632.html,/Structure/cdd/wrpsb.cgi)was performed to confirm the NAC domain of each sequence.

Phylogenetic Analysis and Sequence Alignment

Previously published NAC sequences from Arabidopsis and other species,including Oryza sativa,Brassica napus,Triticum sativa,Antirrhinum majus,were retrieved from the GenBank database.For the phylogenetic analysis,an unrooted tree was constructed with the MEGA5software(Tamura et al.2007) using the Neighbor-Joining method with1000bootstrap replicates.

A multiple sequence alignment of the representative pro-tein sequences of SNAC4-9was performed using the ClustalX1.83program(Thompson et al.1997).The GenBank accession numbers of the reported proteins were the following:CitNAC(EF185419)/AtNAM(AF123311)/ NAP(AJ222713)/AtNAC2(AB049071)/GmNAC1 (AY974349)for NAP and,AtNAC3(AB049070)/ AtNAC019(At1g52890)/AtNAC072(At4g27410)/ GmNAC3(AY974351)/GmNAC4(AY974352)for AtNAC3.

Sequence Analysis

Information regarding the SlNAC gene structures,chromosomal localizations,and transcripts was procured from the SOL data-base.The positions of the SlNAC genes on the tomato chromo-some maps were drawn and modified manually,with annotation. The protein-encoding characteristics were procured from ExPASy ProtParam(https://www.360docs.net/doc/0515045632.html,/protparam/),and the hydrophobic maps were further verified by ProtScale(http://web. https://www.360docs.net/doc/0515045632.html,/protscale).A protein motif analysis was accomplished using the SMART database(http://smart.embl-heidelberg.de/),and the transmembrane proteins were further confirmed by TMHMM(http://www.cbs.dtu.dk/services/ TMHMM-2.0/).The subcellular localizations were predicted by WoLF PSORT(https://www.360docs.net/doc/0515045632.html,/).A transcriptome analysis of various tissues in the tomato cultivar Heinz and the wild relative Solanum pimpinellifolium was used to predict the SlNAC gene expression patterns.The data corresponding to the SlNAC genes were downloaded from the Tomato Expression database(https://www.360docs.net/doc/0515045632.html,/).Based on the data,the heat map was generated using the MeV4.8software(http://www.tm4. org/mev.html)following the instruction of the software.By expressing the signal strength and expression directly reflects the gap,screening candidate genes.The digital expression analysis of tomato SlNAC genes was performed by the visual reflection of signal strength and expression disparity.

RNA Extraction and RT-qPCR Analysis

Isolating RNA from samples ready for the reverse transcriptase quantitative PCR(RT-qPCR)applications was performed using the Column Plant RNAOUT kit(Tiandz#71203,China).The concentration and quality of the RNA samples were examined using spectrophotometer(Nanodrop ND-1000).Samples cDNA was synthesized using the Transcript One-Step gDNA removal and cDNA synthesis supermix(TransGen#AH11-03,China). qPCR analyses of individual genes were designed using Primer5.Briefly,for each qPCR reaction,1μL each diluted sample was used as a template in a25μL reaction containing 12.5μL2×SYBR green supermix(TransGen#AQ101),8.5μL ddH2O and0.5μL of each primer.All qPCR reactions were performed on Light Cycler480thermocycler with45cycles. Cycle threshold(C t)values were determined by the Light Cycler software assuming100%primer efficiency.Theβ-tublin gene was used as an internal control.The Primer pairs used in this research are shown in Table1.For the development analyses,the expression levels of individual genes in the root(R)or pericarp at green stage(G1)were set to1.For the hormone treatment analyses,the expression levels of individual genes under0h treatment were set to1.

Statistical Methods

The RT-qPCR gene expression was quantified using the2-△△Ct comparative methods.Results are presented as the means±standard deviation from three biological replicates of each experiment.The significant differences(p=0.05)between mean values were determined by analysis of variance (ANOV A)using IBM SPSS Statistics20(SPSS commercial software,SPSS Inc.,Chicago,IL,USA)software.

Results

Identification of SlNAC Genes

After the sequencing of the tomato genome was completed, we used10reported NACs as sequence entries for an exhaus-tive search.By removing any redundant sequences and dif-ferent transcripts of the same gene,we identified74putative SlNAC genes preliminarily.The protein-encoding sequences were confirmed by CDD for the presence of the NAM do-main.For convenience,we designated the genes SlNAC1to SlNAC74according to the chromosome distribution.

Phylogenetic Analysis and Sequence Alignment

The clarification of the phylogenetic relationships and classi-fications is important for the functional prediction of this gene family.A combined phylogenetic tree was constructed with the aligned SlNAC and published NAC sequences using the MEGA5software(Fig.1).

Of the74total SlNACs,54SlNACs were divided into12 subgroups with high bootstrap support.The subgroups were

Plant Mol Biol Rep

named by the homologous NACs,according to Ooka’s classifi-cation(Ooka et al.2003).Eleven,nine,seven,and five SlNACs belonged to the NAM,VND,TERN,and ANAC063subgroups, respectively,whereas the NAC2and TIP subgroups contained four SlNACs each,the NAP,A TAF and ANAC011subgroups contained three SlNACs each,the AtNAC3and SENU5sub-groups contained two SlNACs each,and the NAC1subgroup contained one SlNAC.The remaining20sequences had less homology with the known NACs and were clustered into differ-ent unknown subgroups.SlNAC20was clustered as a member of the A TAF subgroup and was most closely related to StNAC. SlNAC46belonged to the NAM subgroup,and SlNAC49was clustered into the NAC1subgroup.SlNAC69was a member of the TERN subgroup.The identities of SlNAC70and NTL,were high,i.e.,approximately99%.Our data showed that SlNAC1 was homologous to SENU5with high bootstraps support. SlNAC48and SlNAC59were highly related,shared99%se-quence similarity and were classified as members of the NAP subgroup.The deduced proteins SlNAC47and SlNAC71were classified as members of the AtNAC3subgroup.For further research,we selected six genes belonged to the NAP and AtNAC3subgroups,and conveniently renamed SlNAC48,71, 59,24,47and19as SNAC4,5,6,7,8and9,respectively,based on a previous report regarding SlNAC3(Han et al.2012).

The amino acid alignments of SNAC4,5,6,7,8and9and other members of the NAP and AtNAC3subgroups are shown in Fig.2.Higher sequence similarities were found in the N-terminus regions.The N-terminnus was composed of approxi-mately150amino acids and contained a conserved NAM do-main,which had five distinguishable subdomains(A–E).The C-terminal regions were divergent in amino acid composition,and contained a number of simple amino acids,such as Ser,Thr,Pro and Glu.

Features of SlNAC Genes

To examine the specific properties of SlNAC genes,we identified their genomic distributions and the structural features of each gene using the SOL database(Supplementary Table1).In total, 74genes were localized on12chromosomes with an uneven distribution(Fig.3).The genes were present in different regions of the chromosomes,including at the telomeric ends,around the centromere,and in between the telomere and the centromere. Chromosome6had the largest number(13)of SlNAC genes, followed by eight genes on chromosomes7and11.In contrast, only two genes were found on chromosome9.Most of the SlNAC genes on chromosomes2,3,6and7were found on the long arms of the chromosomes,whereas the SlNAC genes on chromosomes4,5,8and7were located at both ends.

The SlNAC genes could be classified into three types according to their number indexes of exons/introns.The first type contained48genes with the number index3/2.The second type had six genes that had one or no intron,such as SlNAC12,33and45in the AtNAC063subgroup.The third type could be further divided into smaller subtypes with the number indexes4/3,5/4and6/5.The highest numbers of the exons and introns were found in SlNAC8,which contained17 exons and16introns.

Features of SlNAC Proteins

To analyze the subcellular localizations,conserved domains and motifs of SlNAC proteins,we used website-accessible software as described in materials and methods.As shown in Supplementary Table1,most of the proteins were acidic,with PI values ranging from4.58to7.0,and the highest observed PI value was9.47.The instability indexes ranged from24.28 to61.3,and most SlNAC proteins had an index higher than 40.According to the amino acid indexes,the proteins were rich in Ser,Lys,and Asn.

The subcellular localization predictions suggested that ap-proximately half of the SlNACs were localized in the nucleus, whereas five,four,and three were localized in the peroxisome, cytosol,and chloroplast,respectively.In addition,subcellular localization predictions suggested the cytoskeletal localization of SlNAC5,the mitochondrial localization of SlNAC29,and that SlNAC11and37could be located in either the nucleus or the cytosol.

SlNAC proteins were divergent in their motif compositions. The SlNAC members all had one NAM domain as the charac-teristic conserved domain.Forty-four SlNAC proteins contained one or more low complexity region in the downstream region of

Table1Primer pairs used in this

research Gene Forward-Primer(5′-3′)Reverse-Primer(5′-3′)Tm(°C)

SNAC4TGCCTCTGTTCCTCTTCCTG TCTTGTTCTCCAAATGTCGC53

SNAC5ATTCTCGCTGGGCTCAAAC GGAGGATGGGCGTAAACAT53

SNAC6TGTTGAGAACAACGAGGACG AGGAAATTGGCAA TGGAGC53

SNAC7CTCTGATCTTCCTCCTGGATTT CAGGGATCGAACTTGTAGACAT53

SNAC8CTGGGAACTTCGA TTGGGCT GTTTGA TTTCCCGGCGTTGG53

SNAC9CCCTCCTGGATTTAGGTTTC CCAGGGATCGAACTTATAGACA53

β-tublin CACGTGGGTCCAGCAATAC GGTCAGCAGCACACA TCA TGT60

Plant Mol Biol Rep

the sequence.Some proteins in the TIP and NAC2subgroups had coiled coil regions.SlNAC21,27,64and 65in the A TAF and NAC2subgroups included a transmembrane region.In addition,SlNAC68had two internal repeat regions in sequence,and SlNAC37had a VQ conserved domain.Digital Expression Patterns of SlNAC Genes

To forecast the expression profiles of the SlNAC genes during the tomato development process,we acquired the digital ex-pression normalized (RPKM)data from a transcriptome anal-ysis of various tissues in the tomato cultivar Heinz and the wild relative Solanum pimpinellifolium from the TED data-base.As shown in Fig.4,some members of the NAP,ATAF,AtNAC3,NAC2,TIP and TERN families,such as SlNAC14,20,24,28and 61were constitutively expressed in all of the tested organs.However,members of the VND,NAM and TERN subgroups were weakly expressed.SlNAC9,30,34,

35,52and 72,which belong to subgroup VND,were strongly expressed in the roots,and SlNAC18and 41were strongly expressed in the flower buds and petals.Notably,there were two opposite expression patterns observed during fruit devel-opment.The first,which was observed for SlNAC3,exhibited an increase in expression during maturation.And the second,which was found for SlNAC20,exhibited a decrease in ex-pression in the transition from the immature to mature stages.Tissue-Specific Expression of SNAC Genes

Although the phylogenetic analysis provided important bio-informatics support for candidate genes selection,expression analysis is better for the further investigation of SNAC tran-scription factors.To elucidate the expression patterns of SNAC genes,RT-qPCR analysis was performed (Fig.5).The β-tubulin gene,which was used as an internal control for constitutive expression,was uniformly expressed in all

of

Fig.1Evolutionary relationship of SlNAC and some homologous pro-teins in other plants.The multiple alignment was made using ClustalX and N-J tree was constructed with a 1000-bootstrap replication support.The subfamilies within the NAC family were grouped as indicated.Accession numbers of the reported NACs are as follows:ATAF1(X74755);ATAF2(X74755);AtNAM (AF123311);NAP (AJ222713);AtNAC2(AB049071);TIP (AF281062);CUC1(AB049069);CUC2(AB002560);CUC3(AF543194);AtNAC072(At4g27410);AtNAC3(AB049070);NAC2(AF201456);ANAC055(At3g15500);ANAC019(At1g52890);ANAC011(EFH67253);BnNAC1-1(AY245879);BnNAC3(AY245880);OsNAC1(AB028180);OsNAC2(AB028181);OsNAC3(AB028182);OsNAC4(AB028183);OsNAC5(AB028184);OsNAC6(AB028185);OsNAC7(AB028186);OsNAC8(AB028187);GRAB1(AB028187);GRAB2(AJ010830);NAM (X92205);ZmNAC1(ABY67929);SENU5(Z75524);StNAC (AJ401151);GmNAC1(AY974349);GmNAC2(AY974350);GmNAC3(AY974351);GmNAC4(AY974352);GmNAC5(AY974353);GmNAC6(AY974354);CitNAC (EF185419);TERN (AB021178);CarNAC5(ACS94038);ANAC063(AEE79353);VND1(AEC06722);SND1(ABL67723);NTL8(EFH57163)

Plant Mol Biol Rep

E

D

C B

A

Fig.2Amino acid sequences comparisons between SNAC4-9and members of NAP and AtNAC3subgroup.Identical amino acids are shaded in the same colour.Subdomains in the N-terminal regions were indicated by A-E

Plant Mol Biol Rep

the tissues examined.Each SNAC gene showed a unique expression pattern.SNAC4mRNA was accumulated in all of the tissues at a similar expression level.SNAC5was expressed strongly in the leaves but weakly expressed in the roots and flowers.Moreover,the expression level of SNAC5in young leaves was obviously higher than that obtained in old leaves.The analysis of SNAC6revealed a higher level of expression in the stems and leaves and,a relatively lower expression level in the roots.SNAC7was predominantly expressed in the stems.The expression of SNAC8was mostly observed in old leaves and flowers,but expression was also observed at very low levels in the roots and young leaves,which is different from the expression pattern of SNAC5,although the two genes had a high sequence similarity.The expression pattern was consistent with the development.SNAC9was constitutively expressed in all of the tissues,although a relatively higher level of expression was observed in old leaves.

The expression patterns of SNAC genes during fruit devel-opment were also studied (Fig.6).For the expression analysis,the β-tubulin gene was used as an internal control.In tomato fruits,the expression level of SNAC4increased with the maturation process and reached its highest expression levels at the red ripe stage,which is consisten with the maturation process.The SNAC4expression level was high in the colu-mella at the green mature and breaker stages,but was signif-icantly higher in the pericarp compared with the columella and the radial pericarp late in the maturation process.The analysis of the expression of SNAC5revealed that it is the expressed at higher levels at the pink stage in different parts of the fruits,with no obvious difference.Throughout development,the expression of SNAC5first decreased in the pericarp and then increased,and the lowest level was observed at the breaker stage.The SNAC5expression in the columella presented a clear upward trend,and the highest levels were observed at the

red ripe stage.However,the obvious expression differences between the columella and other regions during the same period still require further investigation.On the whole,the highest expression levels of SNAC6were observed during the pink period,followed by the breaker stage.At the red ripe stage,the tomato fruits progress from late-maturation to the senescence process,and the expression signals for SNAC6slowly weakened.SNAC6expression in the pericarp and radial pericarp was weak in the early stage and gradually increased with the development process.There was a promi-nent increase in the expression of SNAC7in different regions throughout the during the entire development process.The SNAC7expression in the pericarp reached a maximum level at the red ripe stage,whereas its expression in the radial pericarp and columella was low at the pink https://www.360docs.net/doc/0515045632.html,pared with the other genes,SNAC8was expressed in the earliest developmental stage.Fruits at the breaker stage and the red ripe stage exhibited a higher SNAC8expression level.The expression profile of SNAC9was similar to that of SNAC7,and the levels in the pericarp were higher than those obtained in other regions at similar stages.

Expression Profiles with Hormone Treatments

Plant hormones play an important role in the regulation of the development and maturation of fruits.To detect the impact of hormones on the expression of the target genes (SNAC4-9),green mature fruit discs were treated with ABA,IAA,GA,6-BA,SA,and ethylene.

Compared with the control group,SNAC4was observed to be down-regulated following ABA treatment (Fig.7-a).SNAC5were up-regulation during short-term treatment with ABA for 2–6h.ABA treatment promoted SNAC6,SNAC7and SNAC9genes expression during the 6–8h,and the up-regulation of this gene increased with extended

treatment

Fig.3Distributions of SlNAC genes on the 12chromosomes in tomato.Chromosome numbers were indicated at the top of each bar.The scale on the left was in megabases (Mb)

Plant Mol Biol Rep

Fig.4Heat map representation of tissue-specific expression of74 SlNAC genes.Color bar at top shows level of expression.Red indicated expressed genes and green indicated unexpressed ones.R=root;L=leaf; FB,F=flower buds and opened flowers;Fr(1)/(2)/(3)=1/2/3cm fruit, respectively;MG=mature green fruit;Br and Br+10=fruits at breaker and breaker+10days stage.The above were samples of tomato cultivar Heinz.l=leaf;img=immature green fruit;brand br+5=fruit at breaker and breaker+5days stage.The last four ones were samples of Solanum pimpinellifolium

Plant Mol Biol Rep

times.SNAC8displayed a significant induction within 2h,but the transcript accumulation declined to normal levels after 4h of ABA treatment.On the whole,SA treatment had a better effect on the upregulation of SNAC4-9than ABA treatment,and the influence of the treatment time was obvious for some genes (Fig.7-b).SA treatment efficiently induced SNAC5and SNAC6expression within 2h of treatment but did not induce expression after 2h.The expression levels of the genes SNAC7was downregulated,but expression of SNAC9was increased under SA treatment remarkably.

All of the genes,except SNAC9,were down-regulated by GA treatment,and the inhibition of expression was obvious under short-term treatment (Fig.7-c).The expression level of SNAC8,at 4h was 1.5-fold higher than that at 2h.In contrast,an influence of the treatment time on the other genes was not observed.The upregulation of SNAC9by GA was detected,which indicates that this gene is likely to be involved in the GA response pathways.The expression signals were weak in the IAA treatment group and exhibited obvious differences,com-pared with the control group.These results suggest that IAA treatment can inhibit SNAC4-9gene expression (Fig.7-d).Longer treatment times slightly weakened the inhibition,ob-served with the GA treatment,but evident differences were observed between different IAA treatment times.The expression level of SNAC8after 8h of IAA treatment was nearly three-fold higher than that obtained after 2h of treatment,and the former showed little difference with the control group,which suggests that the inhibition was weaker after longer treatment times.The down-regulation of expression was detected after 6-BA treat-ment,which indicates that these genes are likely involved in the 6-BA response pathways (Fig.7-e).The transcript accumulation obtained in the 6-BA treatment groups was similar to that obtained in the control,with some obvious variations.Taken together,these results indicated that SNAC6-9genes were in-volved in the general response to plant hormones.ABA and SA treatment positively regulated SNAC genes expression,whereas GA,IAA and 6-BA down-regulated the accumulation of these transcripts.In addition,the treatment time appears to have an effect on the induction of the expression of these genes.

Because the effects of gas treatment may not be obvious,RT-qPCR analysis was performed to examine the induction of SNAC genes in response to ethylene treatment (Fig.8).Ethylene treatment efficiently induced SNAC genes expression within one day,however,the transcript accumulation declined to normal levels or even lower levels than those obtained in the control group after 24h of treatment.Within 6h of ethylene treatment,SNAC4and SNAC6were down-regulated,but their expression levels exhibited no obvious differences compared with those obtained for the control after 6h of treatment.

R e l a t i v e e x p r e s s i o n

R e l a t i v e e x p r e s s i o n

Fig.5SNAC genes expression in different tissues.R:Root;S:Stem;YL:yong leaves;OL:old leaves;F:flowers.Relative expression levels were calculated and normalized with the respect to the expression of the targeted gene in roots.Significant (P =0.05)differences between means are indicated by different letters.The expression levels of individual genes in the root (R)were set to 1

SNAC4SNAC5SNAC6R e l a t i v e e x p r e s s i o n

SNAC7SNAC8SNAC9

R e l a t i v e e x p r e s s i o n

Fig.6SNAC genes expression in tomato fruits during development and senescence.G:Green mature;B:breaker;P:Pink;R:Red ripe.1:pericarp;2:radial pericarp;3:columella.Relative expression levels were calculated and normalized with the respect to the expression of the targeted gene in green mature fruits pericarp.Significant (P =0.05)dif-ferences between means are indicated by different letters.The expression levels of individual genes in the pericarp at green stage (G1)were set to 1

Plant Mol Biol Rep

R e l a t i v e e x p r e s s i o n

R e l a t i v e e x p r e s s i o n

(a)

ABA treatment

R e l a t i v e e x p r e s s i o n

R e l a t i v e e x p r e s s i o n

(b)

SA treatment

R e l a t i v e e x p r e s s i o n

R e l a t i v e e x p r e s s i o n

(c) GA treatment

(e)

6-BA treatment

R e l a t i v e e x p r e s s i o n

R e l a t i v e e x p r e s s i o n

(d)

IAA treatment

R e l a t i v e e x p r e s s i o n

R e l a t i v e e x p r e s s i o n

Fig.7Effects of exogenous plant hormone (a )ABA,(b )SA,(c )GA,(d )IAA and (e )6-BA on SNAC genes expression.The expression levels of individual genes under 0h treatment were set to 1

Plant Mol Biol Rep

Remarkably,the expression peaks for SNAC4and SNAC6were both detected 8h after treatment,but the transcript accu-mulations decreased with longer treatment times.The SNAC5and SNAC7-9genes presented a similar expression pattern,which showed that the ethylene regulation of SNAC genes presented fluctuations with the extension of the treatment time,as shown in Fig.8.SNAC5and SNAC7-9were expressed at high levels after 2h,6h,and 12h of treatment,and at normal or lower levels after 4h,8h and 10h of treatment.Taken together,these results suggest that short-term treatment with ethylene can promote gene expression,but this effect was suppressed after 24h of treatment.

Discussion

SlNAC Genes May Be Involved in Diverse Physiological Processes in Tomato

The NAC family is a newly discovered transcription factor familly,with a variety of biological functions.NAC genes

have been found in approximately 20species such as Arabidopsis thaliana,Oryza sativa ,Triticum aestivum ,Zea mays ,Solanum tuberosum ,Cucurbita moschata ,Glycine max ,and Citrus sinensis.It has been speculated that there may be over 100NAC genes in tomato (Han et al.2012).Through bioinfor-matics methods,we conducted a genome-wide inventory of the NAC family of transcription factors in tomato.Similar works have been performed by other groups,and the numbers of NAC genes identified differ (http://planttfdb_https://www.360docs.net/doc/0515045632.html,:9010/web/family_view.php?sp=le&fn=NAC&listall=0;https://www.360docs.net/doc/0515045632.html,/cgi-bin/itak/family_gene_list.cgi?acc=NAC&org=Tomato ).We identified 74SlNAC genes from the tomato genome using an e-value of 1e-10and classfied them into 12subgroups in accordance with Ooka ’s nomenclature (Ooka et al.2003).

As shown in Fig.1,SlNAC20belonged to the ATAF subgroup,which participates in the response to biotic and abiotic stress (Ohnishi et al.2005).The NAM subgroup includes the known NAM and CUC3proteins and other proteins with high homology.SlNAC46was clustered as a member of the NAM subgroup,whose members are involved

246810122448

R e l a t i v e e x p r e s s i o n

Hours after treatment (h)SNAC4

R e l a t i v e e x p r e s s i o n

Hours after treatment (h)

2

46810122448R e l a t i v e e x p r e s s i o n

Hours after treatment (h)

SNAC8

2

46810122448R e l a t i v e e x p r e s s i o n

Hours after treatment (h)

SNAC9

R e l a t i v e e x p r e s s i o n

Hours after treatment (h)

SNAC7

R e l a t i v e e x p r e s s i o n

Hours after treatment (h)

SNAC5

Fig.8Effects of exogenous ethylene on SNAC genes

expression.X-ais represents the hours after 100μL/L C2H4and control treatment on AC tomato fruits at greent mature stage.The expression levels of individual genes under 0h treatment were set to 1

Plant Mol Biol Rep

in maintenance of shoot meristems and the separation of cotyledons during the developmental process(Olsen et al. 2005;Guilherme et al.2009).SlNAC49fell into the NAC1 subgroup,which has been shown to be related to the develop-ment of lateral root(Meng et al.2007).SlNAC69was a member of the TERN subgroup,and the members of the TERN group are induced by elicitors of the pathogen response(Ooka et al.2003). SND1in Arabidopsis is the main switch for fiber secondary wall development,and the VND1-7genes are related to vascular bundle development.The SlNACs related to SND1and VND1 were predicted to be involved in plant secondary metabolism processes(Kubo et al.2005;Zhong and Y e2007b;Y amaguchi et al.2008).The TIP subgroup contains the known members NTL and TIP.TIP acts as a positive regulator of defense re-sponses.The TIP subgroup members can influence seed germi-nation during the response to external stimuli(Kim et al.2008; Y oshii et al.2010).SENU5was a subgroup of unknown NAC proteins from tomato and is related to leaf senescence.In addi-tion,the SlNACs in other subgroups have different functions, and some have not yet been functionally characterized.The NAP subgroup includes AtNAP from Arabidopsis,and has been shown to be involved in the development of leaf,siliques,and other organs and senescence(He and Gan2002;Guo and Gan 2006;Uauy et al.2006;Kou et al.2012a,b).The AtNAC3 subgroup includes AtNAC019,055and072,which are induced by ABA and drought stress and potentially enhance plant toler-ance and development(Tran et al.2004;Bu et al.2008;Causier et al.2012).As a class of important transcriptional factors,the NAC proteins in the NAP and AtNAC3subgroups have been proposed to play vital roles during tomato development. According to the analysis conducted in the present study,we targeted SNAC4-9as candidate genes for further research.In summary,the NAC transcription factors in tomato may play divergent roles in plant development,signal transduction and responses to stress.

The Features of Gene and Protein Sequences May Relate

to Gene Functions

The features of the SlNAC genes were systematically analyzed. The alignment analysis results were consistent with previous reports(Ooka et al.2003;Olsen et al.2005).In the present report (Fig.2),the N-terminals were conserved with five subdomains. Subdomains A,C and D were more conserved,and might be responsible for binding DNA and other proteins(Ernst et al. 2004).In contrast,the C-terminals were divergent in composition and length and act as a transcription activators or repressors during transcriptional regulation(Kim et al.2007a).

The genomic distribution data suggested that more SlNAC genes were localized on chromosomes6,7and11,particular-ly at both ends(Fig.3).These results indicate that these chromosomes are more related to the NAC family,but there was no clear association between the gene classification and chromosome location.According to a previous report,the NAC genes of Arabidopsis mostly have three exons and two introns.The first two exons encode the conserved NAC do-main and the third one is responsible for the transcription activation domain(Duval et al.2002).Based on the exon and intron number(Supplementary Table1),the SlNAC genes can be divided into several subfamilies,and most genes contained three exons and two introns,which is in accordance with the features reported for NAC genes.However,there were several genes with number indexes of4/3,5/4and6/5, and the highest numbers of exons and introns found in SlNAC8,which contained17exons and16introns.There is evidence showing that the rate of intron gain is lower than the loss rate after segmental duplication,but the mechanisms are not yet clear(Lin et al.2006;Nuruzzaman et al.2008; Nuruzzaman et al.2010).Based on this evidence,the genes in each subgroup containing more introns may be the original genes of the group.

The protein features were analyzed as shown in Supplementary Table1.The instability index is a measure of the protein stability.Most of the SlNAC proteins had instabil-ity index values higher than40,which suggests that these proteins are unstable.The amino acid index refers to the amino acid contents.Most of the SlNAC proteins were rich in Ser,Lys and Asn,and these amino acids were mostly distributed in the middle and lower reaches of the protein sequences.This distribution of amino acids may be an impor-tant component for the constitution of a specific domain structure in the C-terminals of the proteins.The average hydrophobic values of the SlNAC proteins were negative, which indicates that these proteins are hydrophilic(data not shown).The subcellular localization prediction was performed using the WoLF PSORT software.The subcellular localization demonstrated that the subcellular localizations of the SlNAC proteins are divergent and complex,but most SlNAC proteins were found to be nuclear proteins.The dif-ferences in the subcellular localization may play multiple roles in tomato cells(Li et al.2010).

All of the SlNAC members had one NAM domain as the characteristic conserved domain but were divergent in the compositions of their motifs.Forty-four SlNAC proteins had one or more low complexity regions in the downstream region of the sequence,which also had a higher instability index than the other regions.These regions were abundant in Ser,Asn and other simple amino acids and are thought to play roles as transcriptional activation regions(TARs).The coiled coil regions observed for some of the proteins may be relevant to the higher structures of those proteins.The proteins belonging to the ATAF and NAC2subgroups contained a transmem-brane region.To validate these results,the TMHMM software was used.The exp number of AAs in TMHs(En)is an important parameter and refers to the expected number of amino acids number in the transmembrane helical structure.

Plant Mol Biol Rep

In general,if the index is higher than18,the protein is likely a transmembrane protein or contain signal peptide structures. Through certification,the indexes of SlNAC21,/27,/64,and/ 65were found to be19.770,21.377,20.407and22.830, respectively.The first three were confirmed to have a trans-membrane helical structure in the C-terminus,but that of SlNAC65was in the N-terminus.The exp number,first60 AAs(Ef)is another important parameter.The index found for SlNAC65was greater than10(22.767),which indicate that the so-called transmembrane helical structure in the N-terminus is a signal peptide.

Taken together,the various subcellular localizations and multiple protein motifs may exert assignable impacts on the advanced structures and functions of SlNAC proteins.

SlNAC Genes are Differentially Expressed During Plant and Fruit Development

Increasing evidence has shown that NAC transcription factors are involved in plant development and senescence through tissue-specific expression(Guo and Gan2006;Liu et al. 2009;Huang et al.2012).To forecast the expression profiles of SlNAC genes,we acquired digital expression normalized (RPKM)data(Fig.4).RPKM(Reads per Kilo bases per Million reads)is the most commonly used method for the estimation of the gene expression level and consider the influ-ence of both the sequencing depth and the gene length on the read count.The experiment was performed by the USDA Robert W Holley Center and included Illumina RNA-Seq analyses of the leaves,roots,flower buds,fully opened flowers, and1-cm,2-cm,3-cm sized,mature green,breaker,and break-er+10fruits of the tomato cultivar Heinz,and of the leaves, immature green,breaker,and breaker+5fruits of Solanum pimpinellifolium.Due to variety differences and incomplete measured data,the digital expression can only be used as a reference,and tissues-specific analysis is indispensable.

SNAC4-9genes were moderately expressed in different tissues(Fig.5).The RT-qPCR analysis revealed that SNAC4 and SNAC6may be involved in the development of stems and leaves.SNAC5may play roles in the early development of leaves,because it exhibits a higher expression level in young leaves and may be restrained by the senescence process. SNAC8and SNAC9both regulated the senescence of leaves, and SNAC8was found to be highly expressed in flowers,and thus may be related to flower formation and development.The SNAC8expression pattern was different from that of SNAC5, although the two genes had a high sequence similarity.The different expression patterns of the SNAC genes suggest that their products likely played functionally diverse roles during the processes of tomato growth and development.

The ripening and development of tomato fruits refers to the period from35to55DAF,which includes the green mature, breaker,pink and red ripe stages.A coordinated expression was observed among the six SNAC genes(Fig.6). Interestingly,the expression levels were divergent in the peri-carp,radial pericarp and columella of fruits at similar stages. Brecht reported that the maturity of the different parts of the tomato fruit is also inconsistent(Brecht1987).There was a prominent increase in the expression of SNAC7throughout the development in different regions.The expressions in peri-carp reached a maximum level at the red ripe stage,whereas those in the radial pericarp and columella ware low at the pink stage.These results show that the regulation of SNAC7in the pericarp was later than in the other tissues during develop-ment.In general,SNAC4-9,which belong to the NAP and AtNAC3subgroups,were found to be involved in the regu-lation of tomato fruit development.These results indicate that the phylogenetic analysis is reliable to a certain degree. SNAC4,SNAC6and SNAC7showed similar expression pat-terns during the green mature and breaker stages,but exhibited significant differences at the pink and red ripe stages.Based on the overall similarity of the expression patterns of the SlNAC genes,it is tempting to speculate that these genes participate in the same or similar regulatory networks. Currently,we do not know the exact roles of SlNAC genes in fruit ripening.However,it is possible that the proteins are involved in ethylene-stimulated or hormone signaling pathways.

SlNAC Genes Are Involved in the Response to Hormone The hormone levels in vivo and hormone treatment in vitro play crucial roles during fruit and vegetable maturation pro-cesses.Hormones also affect the ripening-related gene expres-sion,ethylene production,and the effects of ethylene.The regulation of plant hormones during plant growth,fruit ripen-ing and senescence is a complex process that depends not only on hormone concentrations,but also on the balance and inter-action between different hormones.Previous studies have mostly focused on the effect of hormones on the regulating of the stress response by NAC genes(Shinozaki and Yamaguchi-Shinozaki2000;2007;Peng et al.2009;Zhang et al.2012;Han et al.2012),and few studies have examined the effect of hormones on the fruit ripening mechanisms mediated by NAC genes.The present experiment examined the effects of0.1mM ABA,0.l mM GA,0.l mM IAA, 0.1mM6-BA and1mM SA treatment on AC green mature tomato fruit tissue discs to analyze the roles of SNAC4-9gene expression on the regulation of maturity.

Abscisic acid(ABA)is an important factor in the regula-tion of fruit ripening and senescence as well as ethylene, which is effective for fruit ripening,abiotic stresses and other aspects.ABA has close ties to ethylene generation(Josph et al.1990),and may be an endogenous regulatory factor located upstream of ethylene during the apple ripening process to promote ethylene production.It has been reported that the

Plant Mol Biol Rep

ABA levels increase during fruit ripening,and that ABA can stimulate endogenous ethylene synthesis,which indicates that there is cross-talk between ABA and ethylene(Beaudoin et al. 2000;Carbonell-Bejerano et al.2010;Zhang et al.2012). Recently,it was shown that ABA treatment can promote respiration and ethylene production in WT siliques,but has no effect on the atnap mutant siliques,which indicates that ABA may regulate ethylene through NAC genes(Kou et al. 2012a,b).The results of the present study showed that the SNAC5-9genes can promote the mature development of fruit through the ABA pathway(Fig.7-a).

Salicylic acid(SA)is a plant growth regulator involved in growth,development,maturation,senescence,stress resis-tance induction and other metabolic processes(Manoj and Srivastava2000).At present,the mechanisms of SA in fruit ripening,softening and ripening-related gene expression reg-ulation have not been well investigated.In the present study, treatment with1mM SA significantly promoted NAC gene expression in AC tomato fruit tissue discs,and the effect was stronger than that of ABA(Fig.7-b).

Gibberellic acid(GA)can play an important role in seed germination,stem elongation,flower induction and seed for-mation throughout the entire life-cycle of higher plants. Studies have shown that GA can inhibit fruit chlorophyll and peroxidase activity,and thereby delays strawberry fruit coloring(Martinez et al.1996).Treatment with0.1mM GA was shown to inhibit SNAC gene expression in the present experiment,and this inhibition was weakened with the exten-sion of the treatment time(Fig.7-c).

Similarly,indole acetic acid(IAA)can also play a regula-tory role in the plant growth and development stages.It has been reported that the majority of gene expression is negative regulated by IAA during the strawberry growth and mature aging processes(Civello et al.1999).Bouzayen(2002)sug-gested that there is a signaling conversation between IAA and ethylene in tomato ripening-related transcription regulation. IAA regulates plants metabolism,because exogenous auxin can promote ethylene production and after-ripening and reg-ulates both the tissue reaction to ethylene and the inhibitory effects of ripening(Kende and Zeevaart1997).The roles of IAA at high levels(100to1000μM)and low levels(1to 10μM)are different within the threshold value.A high concentration of IAA can stimulate ethylene production,and may promote after-ripening.In contrast,a low concentration of IAA can inhibit ethylene production to delay ripening.In this experiment,treatment with IAA inhibited the gene ex-pression of the NAC genes,which can delay fruit maturation (Fig.7-d).

6-Benzylaminopurine(6-BA)was the first artificially syn-thesized cytokinin,and can inhibit the decomposition of plant leaf chlorophyll,nucleic acids and protein to keep green fruits immature.However,the test crop types,usage,concentration, treatment time and location can affect the reactions of a plant to6-BA treatment.The6-BA treatment in the present exper-iment showed an inhibitory effect on SNAC gene expression (Fig.7-e).

It is widely accepted that ethylene is an important factor that promote fruit and leave senescence(Oeller et al.1991; Watkins2002;Giovannoni2004;Jing et al.2005;Kou et al. 2012a,b),but the link between ethylene and NAC transcrip-tion factors is barely understood.It has been reported that exogenous ethylene treatment promotes the earlier occurrence of the surge in respiration in WT siliques,but the treatment did not alter the respiration pattern in the atnap mutant siliques, which suggests that ethylene may regulate fruit development through NAC genes(Kou et al.2012a,b).In this study,SNAC genes were up-regulated in response to short-time ethylene treatment within24hours.In contrast,the induction declined to normal or lower levels after24h of treatment(Fig.8). These data indicate that SlNAC genes are involved in ethylene pathways during fruit senescence,but further analysis is required.

Acknowledgements This work was supported by the National Natural Science Foundation of China(project no.31171769)and Postdoctoral Science Founding Special Foundation Project of China(project no. 201003300)

Conflict of Interest The authors have declared no conflict of interest. Reference

Aida M,Ishida T,Fukaki H,Fujisawa H,Tasaka M(1997)Genes involved in organ separation in Arabidopsis:an analysis of the cup-shaped cotyledon mutant.Plant Cell9:841–857

Alexander L,Grierson D(2002)Ethylene biosynthesis and action in tomato:a model for climacteric fruit ripening.J Exp Bot 53:2039–2055

Beaudoin N,Serizet C,Gosti(2000)Interactions between abscisic acid and ethylene signaling acscades.The Plant Cell12: 1103–1115

Bouzayen M(2002)Ripening-associated transcriptional regulation in the tomato.A case of cross-talk between ethylene and auxin.

Comparative Biochemistry and Physiology,Part A:Molecular and Integrative.Physiology132:S97

Brecht JK(1987)Locular gel formation in developing tomato fruit and initiation of ethylene production.Hortscience22(3):476–479

Bu Q,Jiang H,Li CB,Zhai Q,Zhang J,Wu X,Sun J,Xie Q,Li C(2008) Role of the Arabidopsis thaliana NAC transcription factors ANAC019and ANAC055in regulating jasmonic acid-signaled defense responses.Cell Res18:756–767

Carbonell-Bejerano P,Urbez C,Carbonell J,Granell A,Perez-Amador MA(2010)A fertilization-independent develop-mental program triggers partial fruit development and se-nescence processes in pistills of Arabidopsis.Plant Physiol 154:163–172

Causier B,Ashworth M,Guo W,Davies B(2012)The TOPLESS interactome:a framework for gene repression in Arabidopsis.

Plant Physiol158:423–438

Civello PM,Powell AL,Sabehat A(1999)An expansion gene expressed in ripening strawberry fruit.Plant Physiol121:1273–1279

Plant Mol Biol Rep

Duval M,Hsieh TF,Kim SY,Thomas TL(2002)Molecular characteri-zation of AtNAM:a member of the Arabidopsis NACdomain superfamily.Plant Mol Biol50:237–248

Ernst HA,Olsen AN,Skriver K,Larsen S,Lo Leggio L(2004)Structure of the conserved domain of ANAC,a member of the NAC family of transcription factors.EMBO Rep5:297–303

Fang Y,You J,Xie K,Xie W,Xiong L(2008)Systematic sequence analysis and identification of tissue-specificor stress-responsive genes of NAC transcription factor family in rice.Mol Gen Genomics280:547–563

Fujita M,Fujita Y,Maruyama K,Seki M,Hiratsu K,Ohme-Takagi M, Tran LS,Yamaguchi-Shinozaki K,Shinozaki K(2004)A dehydration-induced NAC protein,RD26,is involved in a novel ABA-dependent stress-signaling pathway.Plant J39:863–876 Giovannoni JJ(2004)Genetic regulation of fruit development and ripen-ing.Plant Cell Online16(suppl1):S170–S180

Guilherme LP,Carolina SM,Maximiller DC,Pedro AR,Murilo SA, Claudine MC,Luciano GF,Elizabeth PF(2009)Complete inventory of soybean NAC transcription factors:sequence conservation and expression analysis uncover their distinct roles in stress response.

Gene444:10–23

Guo YF,Gan SS(2006)AtNAP,a NAC family transcription factor,has an important role in leaf senescence.Plant J46:601–612

Han QQ,Zhang JH,Li HX,Luo ZD,KhurramZiaf WTT,Ye ZB(2012) Identification and expression pattern of one stress-responsive NAC gene from Solanum lycopersicum.Mol Biol Rep39:1713–1720 He XJ,Mu RL,Cao WH,Zhang ZG,Zhang JS,Chen SY(2005) AtNAC2,a transcription factor downstream of ethylene and auxin signaling pathways,is involved in salt stress response and lateral root development.Plant J44:903–916

He YH,Gan SS(2002)A gene encoding an acyl hydrolase is involved in leaf senescence in Arabidopsis.Plant Cell14:805–815

Hu HH,Dai MQ,Yao JL,Xiao BZ,Li XH,Zhang QF,Xiong LZ(2006) Overexpressing a NAM,ATAF,and CUC(NAC)transcription factor enhances drought resistance and salt tolerance in rice.Proc Natl Acad Sci103:12987–12992

Hu HH,You J,Fang YJ,Zhu XY,Qi ZY,Xiong LZ(2008) Characterization of transcription factor gene SNAC2conferring cold and salt tolerance in rice.Plant Mol Biol67:169–181

Huang H,Wang Y,Wang S,Wu X,Yang K,Niu Y,Dai SL(2012) Transcriptome-wide survey and expression analysis of stress-responsive NAC genes in Chrysanthemum lavandulifolium.Plant Sci193:18–27

International Tomato Genome Sequencing Project(2012)The tomato genome sequence provides insights into fleshy fruit evolution.

Nature485:635–641

Jeong JS,Kim YS,Baek KH,Hairn J,Ha SH,Choi YD,Minkyun K, Reuzeau C,Kim JK(2010)Root-specific expression of OsNAC10 improves drought tolerance and grain yield in rice under field drought conditions.Plant Physiologyl153:185–197

Jing HC,Schippers JHM,Hille J,Dijkwel PP(2005)Ethylene-induced leaf senescence depends on age-related changes and OLD genes in Arabidopsis.J Exp Bot56:2915–2923

Josph R,Eliahu G,Yang SF(1990)Characterization of abscisic acid-induced ethylene production in citrus leaf and tomato fruit tissues.

Plant Physiol92:48–53

Kende H,Zeevaart JAD(1997)The five classical plant hormones.Plant Cell9:1197–1210

Kim SG,Kim SY,Park CM(2007a)A membrane-associated NAC transcription factor regulates salt-responsive flowering via FLOWERING LOCUS T in Arabidopsis.Planta226:647–654 Kim SG,Lee AK,Y oon HK,Park CM(2008)A membrane bound NAC transcription factor NTL8regulates gibberellic acid mediated salt sig-naling in Arabidopsis seed germination.Plant Journal55(1):77–88 Kim SY,Kim SG,Kim YS,Seo PJ,Bae M,Yoon HK,Park CM(2007b) Exploring membrane-associated NAC transcription factors in

Arabidopsis:implications for membrane biology in genome regu-lation.Nucleic Acids Res35:203–213

Kim YS,Kim SG,Park JE(2006)A membrane-bound NAC transcription factor regulates cell division in Arabidopsis.Plant Cell18:3132–3144

Klee HJ,Giovannoni JJ(2011)Genetics and control of tomato fruit ripening and quality attributes.Annu Rev Genet45:41–59

Ko JH,Yang SH,Park AH,Lerouxel O,Han KH(2007)ANAC012,a member of the plant-specific NAC transcription factor family,neg-atively regulates xylary fiber development in Arabidopsis thaliana.

Plant J50:1035–1048

Kou XH,Watkins CB,Gan SS(2012)Arabidopsis AtNAP regulates fruit senescence.J Exp Bot63:6139–6147

Kubo M,Udagawa M,Nishikubo N,Horiguchi G,Yamaguchi M,Ito J, Mimura T,Fukuda H,Demura T(2005)Transcription switches for protoxylem and metaxylem vessel formation.Genes Dev19:1855–1860

Li LB,Zhang YR,Liu KC,Ni ZF,Fang ZJ,Sun QX,Gao JW(2010) Identification and bioinformatics analysis of SnRK2and CIPK family genes in sorghum.Agric Sci China9:19–30

Lin HN,Zhu W,Silva CJ,Gu X,Buell CR(2006)Intron gain and loss in segmentally duplicated genes in rice.Genome Biol7:R41

Lin R,Zhao W,Meng X,Wang M,Peng Y(2007)Rice gene OsNAC19 encodes a novel NAC-domain transcription factor and responds to infection by Magnaporthe grisea.Plant Sci172:120–130

Liu YZ,Baig MN,Fan R,Ye JL,Cao YC,Deng XX(2009)Identification and expression pattern of a novel NAM,ATAF,and CUC-like gene from Citrus sinensis Osbeck.Plant Mol Biol Rep27:292–297 Manoj K,Srivastava UN(2000)Delayed ripening of banana fruit by salicylic acid.Plant Sci158:87–96

Mao C,Ding W,Wu Y,Yu J,He X,Shou H,Wu P(2007)Overexpression of a NAC-domain protein promotes shoot branching in rice.New Phytol176:288–298

Martinez GA,Chaves AR,Anon MC(1996)Effect of exogenous appli-cation of gibberellic acid on color change and phenylalanine ammonia-lyase,chlorophyllase,and peroxidase activities during ripening of strawberry fruit(Fragaria×ananassa Duch.).J Plant Growth Regul15:139–146

Meng Q,Zhang C,Gai J,Yu D(2007)Molecular cloning,sequence characterization and tissue-specific expression of six NAC-like genes in soybean(Glycine max(L.)Merr.).J Plant Physiol164: 1002–1012

Nuruzzaman M,Gupta M,Zhang CJ,Wang L,Xie WB,Xiong LZ, Zhang QF,Lian XM(2008)Sequence and expression analysis of the thioredoxin protein gene family in rice.Mol Gen Genomics280: 139–151

Nuruzzaman M,Manimekalai R,Sharoni AM,Satoh K,Kondoh H, Ooka H,Kikuchi S(2010)Genome-wide analysis of NAC tran-scription factor family in rice.Gene465:30–44

Oeller PW,Lu MW,Taylor LP,Pike DA,Theologis A(1991)Reversible inhibition of tomato fruit senescence by antisense RNA.Science 254:437–439

Ogo Y,Kobayashi T,Nakanishi-Itai R,Nakanishi H,Kakei Y,Takahashi M,Toki S,Mori S,Nishizawa NK(2008)A novel NAC transcrip-tion factor,IDEF2,that recognizes the iron deficiency-responsive element2regulates the genes involved in iron homeostasis in plants.

J Biol Chem283:13407–13417

Ohnishi T,Sugahara S,Yamada T,Kikuchi K,Yoshiba Y,Hirano HY, Tsutsumi N(2005)OsNAC6,a member of the NAC gene family,is induced by various stresses in rice.Gene Genet Syst80:135–139 Olsen AN,Ernst HA,Leggio LL(2005)NAC transcription factors: structurally distinct,functionally diverse.Trends Plant Sci10:79–87 Ooka H,Satoh K,Doi K,Nagata T,Otomo Y,Murakami K,Matsubara K, Osato N,Kawai J,Carninci P(2003)Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana.DNA Res10:239–247

Plant Mol Biol Rep

Peng H,Cheng HY,Yu XW,Shi QH,Zhang H,Li JG,Ma H(2009) Characterization of a chickpea(Cicerarietinum L.)NACfamily gene,CarNAC5,which is both developmentally-and stress-regulated.Plant Physiol Biochem47:1037–1045

Sablowski RW,Meyerowitz EM(1998)A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLA TA.Cell92:93–103

Shinozaki K,Y amaguchi-Shinozaki K(2000)Molecular responses to dehy-dration and low temperature,differences and cross-talk between two stress signaling pathways.Curr Opin Plant Biol l3:217–223 Shinozaki K,Yamaguchi-Shinozaki K(2007)Gene networks in-volved in drought stress response and tolerance.J Exprimental Bot58:221–227

Souer E,van Houwelingen A,Kloos D,Mol J,Koes R(1996)The No Apical Meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries.Cell85:159–170

Sperotto RA(2009)Identification of up-regulated genes in flag leaves during rice grain filling and characterization of OsNAC5,a new ABA-dependent transcription factor.Planta230:985–1002 Tamura K,Dudley J,Nei M(2007)MEGA4:molecular evolutionary genetics analysis(MEGA)software version4.0.Mol Biol Evol24: 1596–1599

Thompson JD,Gibson TJ,Plewniak F,Jeanmougin F,Higgins DG (1997)The CLUSTAL-X windows interface:flexible strategies for multiple sequence alignment aided by quality analysis tools.Nucleic Acids Res25:4876–4882

Tran LS,Nakashima K,Sakuma Y,Simpson SD,Fujita Y,Maruyama K, Fujita M,Seki M,Shinozaki K,Yamaguchi-Shinozaki K(2004) Isolation and functional analysis of Arabidopsis stress-inducible

NAC transcription factors that bind to a drought-responsive cis-element in the earlyresponsive to dehydration stress1promoter.

Plant Cell16:2481–2498

Uauy C,Distelfeld A,Fahima T,Blechl A,Dubcovsky J(2006)A NAC gene regulating senescence improves grain protein,zinc,and iron content in wheat.Science314:1298–1301

Watkins CB(2002)Ethylene synthesis,mode of action,consequences and control.In:Knee M(ed)Fruit quality and its biological basis.

Sheffield Academic Press,Sheffield,pp180–224

Weir I,Lu J,Cook H,Causier B,Schwarz SZ,Davies B(2004) CUPULIFORMIS establishes lateral organ boundaries in Antirrhinum.Development131:915–922

Xie Q,Frugis G,Colgan D,Chua NH(2000)Arabidopsis NAC1trans-duces auxin signal downstream of TIR1to promote lateral root development.Gene Dev14:3024–3036

Yamaguchi M,Kubo M,Fukuda H,Demura T(2008)Vascular related NAC-domain7is involved in the differentiation of all types of xylem vessels in Arabidopsis roots and shoots.Plant J55:652–664 Yoshii M,Yamazaki M,Rakwal R,Kishi-Kaboshi M,Miyao A, Hirochika H(2010)The NAC transcription factor RIM1of rice is

a new regulator of jasmonate signaling.Plant J61:804–815 Zhang K,Xia X,Zhang Y,Gan SS(2012)An ABA-regulated and Golgi-localized protein phosphatase controls water loss during leaf senes-cence in Arabidopsis.Plant J69:667–678

Zhong RQ,Richardson EA,Ye ZH(2007b)Two NAC domain transcrip-tion factors,SND1and NST1,function redundantly in regulation of secondary wall synthesis in fibers of Arabidopsis.Planta225:1603–1611

Zhong RQ,Ye ZH(2007)Regulation of cell wall biosynthesis.Curr Opin Plant Biol10:564–572

Plant Mol Biol Rep