Identification of bovine NPC1 gene cSNPs and their effectson body size traits of Qinchuan cattle

Identi ?cation of bovine NPC1gene cSNPs and their effects on body size traits of Qinchuan cattle

Yonglong Dang a ,Mingxun Li a ,Mingjuan Yang a ,Xiukai Cao a ,Xianyong Lan a ,Chuzhao Lei a ,Chunlei Zhang b ,Qing Lin a ,Hong Chen a ,?

a College of Animal Science and Technology,Northwest A &F University,Shaanxi Key Laboratory of Molecular Biology for Agriculture,Yangling,Shaanxi 712100,China b

Institute of Cellular and Molecular Biology,Jiangsu Normal University,Xuzhou,Jiangsu 221116,China

a b s t r a c t

a r t i c l e i n f o Article history:

Accepted 3March 2014

Available online 4March 2014

Keywords:NPC1gene

Coding single nucleotide polymorphisms (cSNPs)

Missense mutation Combined haplotypes Body size traits

NPC1gene is an important gene closely related to the Niemann –Pick type C (NPC).Mutations in the NPC1gene tend to cause Niemann –Pick type C,a lysosomal storage disorder.Previous studies have shown that NPC1protein plays an important role in subcellular lipid transport,homeostasis,platelet function and formation,which are basic metabolic activities in the process of development.In this study,to explore the association between the NPC1gene variation and body size traits in Qinchuan cattle,we detected four novel coding single nucleotide poly-morphisms (cSNPs)in the bovine NPC1gene,including one missense mutation (SNP1)and three synonymous mutations (SNP2,SNP3and SNP4).Population genetic analyses of 518individuals and association correlations between cSNPs and bovine body size traits were conducted in this research.A missense mutation at SNP1locus was found to be signi ?cantly related to the heart girth,hip width and body weight (P b 0.01or P b 0.05,3.5-year-old).Two synonymous mutations at SNP2and SNP3loci also showed signi ?cant effects on hip width (P b 0.05,3.5-year-old).One synonymous mutation at SNP4locus showed signi ?cant effect on body weight (P b 0.05,2.0-year-old).Combined haplotypes H 2H 6and H 6H 6showed signi ?cant effects on body size traits such as heart girth,hip width,and body weight (3.5-year-old,P b 0.01or P b 0.05).This study provides ev-idence that the NPC1gene might be involved in the regulation of bovine growth and body development,and may be considered as a candidate gene for marker assisted selection (MAS)in beef cattle breeding industry.

?2014Published by Elsevier B.V.

1.Introduction

Niemann –Pick type C1(NPC1)was identi ?ed as the gene that when mutated results in Niemann –Pick disease type C,a rare autosomal re-cessive lipidosis.Patients suffer from NPC exhibit progressive neurode-generation and hepatosplenomegaly,leading to death during early childhood (Scriver,2001).The gene encodes an approximately 4.9kb messenger RNA that is predicted to produce a 1278-amino-acid protein (Scott and Ioannou,2004).The NPC1gene spans ~47kb and contains 25exons,ranging in size from 74to 788nucleotides,and introns ranging in size from 0.097to 7kb (Morris et al.,1999).

Evidences showed that the NPC1and NPC2proteins function in con-cert to facilitate the intracellular transport of lipids from the lysosome to

other cellular sites (Sleat et al.,2004).A major source of cellular choles-terol is endocytosed as low density lipoprotein,which is delivered to late endosomes and lysosomes where cholesterol is released (Brown and Goldstein,1986).Within late endosomes and lysosomes,NPC1and NPC2proteins are required for the subsequent delivery of choles-terol to other intracellular compartments (Pentchev,2004).NPC1pro-tein is needed for cellular utilization of low-density lipoprotein-derived cholesterol that has been delivered to lysosomes.The protein encoded by the NPC1gene is a multitransmembrane protein that local-izes to late endosomes.It has 13transmembrane domains,three large loops that protrude into the late endosome lumen,several smaller cyto-plasmic loops,and a C-terminal cytoplasmic tail (Davies and Ioannou,2000).Transport studies in NPC1-expressing E.coli showed that NPC1can transport fatty acids,which implies it may have essential function in the process of body development.

NPC1protein was located in endosomes that mediate cholesterol export to the ER (van der Kant et al.,2013).NPC1's lumenally oriented,N-terminal domain binds cholesterol and has been proposed to receive cholesterol from NPC2protein as part of the process by which cholester-ol is exported from lysosomes into the cytosol (Def ?eu and Pfeffer,2011).Based on previous studies,the mechanism of cholesterol trans-port involved in NPC1gene has been preliminarily clari ?ed (Ohgane

Gene 540(2014)153–160

Abbreviations:cSNPs,coding single nucleotide polymorphisms;bp,base pair(s);NPC,Niemann –Pick type C;GLM,general linear model;He ,observed heterozygosity;Ho ,ob-served homozygosity;HWE,Hardy –Weinberg equilibrium;LD,linkage disequilibrium;MAS,marker assisted selection;Ne ,effective allele numbers;PCR –RFLP,polymerase chain reaction –restricted fragment length polymorphisms;PIC,polymorphism informa-tion content;QC,Qinchuan cattle;SE,standard error.

?Corresponding author at:No.22Xinong Road,College of Animal Science and Technology,Northwest A&F University,Yangling,Shaanxi 712100,China.

E-mail address:chenhong1212@https://www.360docs.net/doc/0917657796.html, (H.

Chen).https://www.360docs.net/doc/0917657796.html,/10.1016/j.gene.2014.03.0010378-1119/?2014Published by Elsevier

B.V.

Contents lists available at ScienceDirect

Gene

j o u r n a l h o m e p a g e :w w w.e l s e v i e r.c o m /l o c a t e /g e n e

et al.,2013),which indicate that the function of the NPC1gene in choles-terol transportation is essential and important.

Although we have got a general idea of the role that the NPC1gene plays on cholesterol transportation,more functions of it such as its asso-ciation with obesity or growth traits and the mechanism remain to be explored.Mutations in the NPC1gene have been strongly linked with obesity(Meyre et al.,2009).A genome-wide association study identi-?ed NPC1gene mutations as a risk factor in childhood obesity and adult morbid obesity,and1416age-matched normal weight controls (Meyre et al.,2009).Mutations in the NPC1gene were also correlated with ordinary weight gain in the European population(Meyre et al., 2009).Previous studies in mice have suggested that the NPC1gene has a role in controlling appetite,as mice with a non-functioning NPC1 gene suffer late-onset weight loss and have poor food intake(Xie et al.,1999).NPC1gene variant could account for around10%of all childhood obesity and about14%of adult morbid obesity cases(Meyre et al.,2009).A recent study reported that NPC1defect resulted in abnor-mal platelet formation and function which imply that NPC1gene may show a role in platelet function and formation(Louwette et al.,2013).

Numerous previous studies on NPC1gene mainly focus on Niemann–Pick type C and its treatment.However,the variations of the NPC1gene and their effects on body size traits have not been reported in cattle,although the NCP1gene is located on bovine chromosome24 in a region near two important QTLs related to limb conformation and body conformation traits(Zimin et al.,2009).Moreover,linkage analysis and association analysis are two effective ways to study genes and their connection with traits(Durrant et al.,2004).So,exploring the correla-tion between mutation markers and body size traits is meaningful and rewarding in beef cattle industry.The aim of the present study is to de-tect mutations in the NPC1gene in cattle,and then to explore the asso-ciation between these mutations and bovine body size traits.

2.Materials and methods

The current investigation involved sampling,body measurement, DNA extraction,mutation loci detection,genotypic identi?cation and association analyses.

2.1.Sample resource,body measurement and DNA samples

Five hundred and eighteen Chinese Qinchuan cattle were used in this study.The populations were from the reserved farm of Qinchuan cattle(Fufeng County,Shaanxi province,P.R.China)and were raised on a corn–corn silage diet after weaning at an average of6months.

We combined cattle born in different years into2.0and3.5year-old groups.Although they were born in different years,the body size traits were measured when they were2.0or3.5years old.The2.0-year-old group consisted of216individuals,while the3.5-year-old group contained243individuals.All animals in each group were healthy breeding females with no pregnancy.

Ten important body size traits were associated in this research in-cluding body height,height at hip cross,body length,heart girth,chest width,chest depth,rump length,hucklebone width,hip width,and body weight.These traits were measured with reference to Gilbert's method(Gilbert et al.,1993).

DNA of518cows was isolated from2%heparin-treated blood sam-ples which were stored at?80°C,following the standard procedures (Sambrook et al.,2001).The content of DNA was estimated using specif-ic spectrophotometer equipment,and then was diluted to50ng/μL.All DNA samples were stored at?20°C before subsequent use.

2.2.Mutation loci detection and genotypic identi?cation

A total of23primer pairs were designed according to the bovine NPC1gene sequence available in NCBI database(GenBank Accession Number:NM_174758)to amplify the25exons.Partial primers'infor-mation used for detecting all novel mutations was shown in Table1. PCR was performed in25μL of reaction volume,containing50ng geno-mic DNA,10μM of each primer,1×buffer(including1.5mM MgCl2), 200μM dNTPs and0.6U of Taq DNA polymerase(MBI,Vilnius, Lithuania).To optimize the ef?ciency while searching the possible mu-tation loci,DNA pool sequencing was used in this study.About100indi-viduals'genomic DNA was pooled together.Then PCR ampli?cations were carried out with pooled DNA as template.Then PCR products were sequenced by Sangon Biotech Company to preliminarily search the possible mutation loci.

The sequencing results were read by the Chromas software,those with two peaks in the same locus were considered as the candidate SNPs.Then the sequencing sequences were imported into the BioXM software version2.6to make comparisons with the reference sequence (Accession Number:NM_174758)to locate the SNPs.Those SNPs matched to the exons were considered as cSNPs.

Restriction enzyme digestion primers were designed to identify the genotype of the possible mutation loci using PCR-RFLP technique.4μL PCR products were mixed with6μL enzyme digestion solution(4.8μL water,0.2μL enzyme and1μL10×buffer),and then the10μL reaction system was conducted according to the supplier's instructions.Finally, the digested products were detected by electrophoresis in2%agarose gel,and were run at a constant voltage(120V)for about0.5to1.0h to identify the genotype.The type of mutation was identi?ed by making a comparison between the two peptides before and after the mutation through BioXM software version2.6.

2.3.Data analyses

The associations between genotypes and body size traits of a 2.0-year-old Qinchuan cattle population and a3.5-year-old Qinchuan cattle population were analyzed in this study.

Hardy–Weinberg equilibrium(HWE)was tested based on chi-square test for different mutation loci(Yeh,1997).Heterozygosity (H e),homozygosity(H o)and effective allele numbers(Ne,reciprocal of homozygosity),three indexes to measure genic variation of a popula-tion,were calculated according to Nei's methods(Nei,1973).All the cal-culation or test above along with the calculation of genotypic frequency

Table1

Partial primers with mutations detected.

Primer name Loci a Primer sequences(5′–3′)Tm(°C)SAF(bp)b Composition of fragments

P1SNP1F:CCATCTTATCCTCTGCCTCC61707Exon2,partial introns1and2

R:ACCCCAGAAAAATGACGCCT

P2SNP2and SNP3F:GAGGCTTATGTATGAGTTCT56714Exon8,partial intron8and intron9

R:TAAACCATCACACTCAGCC

P3SNP4F:TGACACCCGCAGACAAAGT58813Exon15,exon16,intron16,partial introns15and17

R:CCAAAGCCCCCAAAACTGT

a SNP loci,SNP1,g.G10710A;SNP2,g.C21992T;SNP3,g.C22007T;SNP4,g.T36976C.

b SAF,size of ampli?cation fragment.

154Y.Dang et al./Gene540(2014)153–160

and allele frequency was performed with POPGENE software(version 1.32).

Polymorphism information content(PIC)was calculated by PIC_Calc (version0.6)according to Botstein's methods(Botstein et al.,1980). Linkage disequilibrium analysis was completed according to Lewontin's method(Lewontin,1988).r2coef?cient between each pair of mutations along with haplotype screening in the studied Qinchuan cattle was esti-mated by the SHEsis online service(Yong and Lin,2005).The relation-ships between the variations of the NPC1gene and body size traits were analyzed by ANOVA(SPSS Statistics,version17.0,GLM proce-dure).A univariate model was used,where the responses were heart girth,hip width and body weight,etc.This is a single locus model,all analyses were done in two steps,?rst using a full animal model and then using a reduced animal model.

The full animal model included the observed value of the target trait, effect of marker genotype,birth year,age,seasons of birth,age of dam, sire,farm,sex,and random effects(environmental differences and re-sidual).The effect associated with seasons of birth(spring vs fall),age of dam,sire,farm,and sex was not matched in the linear model,as

the preliminary statistical analyses indicated that these effects did not have a signi?cant in?uence on variability of traits in the analyzed popu-lations.So,they were classi?ed into the residual.Then the reduced model was used in the?nal analysis(Henderson,1986;Huang et al., 2011).The SPSS software was used to analyze the relationship between the genotypes and body size traits in cattle.The reduced linear model is as follows:

Y ijk?μtA itG jtεi jk

where Y ijk is the observed value of the target trait,μis the overall mean of each target trait,A i is the?xed effect,indicating age group,G i is the effect of marker genotype andεijk is the residual error.Pair-wise con-trasts were performed for pairs of genotypes,as well as combined hap-lotypes to?nd loci or combined haplotypes signi?cantly associated with body size traits.Effect size of each signi?cant genotype or combined haplotype was described by a determination coef?cient(R-square) which was calculated in SPSS(regression).3.Results

3.1.Mutation loci detection and genotype identi?cation

Four novel mutations were detected in the NPC1gene in the Qinchuan cattle,including1missense mutation(g.10710G N A,Fig.1)and3synon-ymous mutations(g.21992C N T,g.22007C N T,g.36976T N C.Fig.1).The NPC1topology structure and the mutation location in the protein se-quence were shown in Fig.2.More information in details about the muta-tions was shown in Table2.

PCR–RFLP was used to identify the genotypes of each mutation locus, and three genotypes were discovered in each of the four mutation loci (Fig.3).As for SNP1,the restriction enzyme XspΙwas used to identify the genotype.After being digested for10h by XspΙ,the AA allele showed one fragment(92bp)without restriction enzyme cutting site, the GG allele showed two fragments(33and59bp),while three frag-ments(92,59and33bp)stood for AG allele(Fig.3a).As for SNP2,the restriction enzyme RsaΙdigested264bp PCR products and formed one fragment(264bp)for TT allele,two fragments(236and28

bp) Fig.1.The sequencing maps of four novel cSNPs in the bovine NPC1gene.Note:The SNP positions are shown according to GenBank accession No.

NM_174758.

Fig.2.A diagrammatic drawing of the NPC1topology structure and the SNP location based

on a published model(Davies and Ioannou,2000;Scott and Ioannou,2004).The?rst SNP

locates in loop A,causing amino acid E mutate into L,while the second(SNP2),third

(SNP3)and fourth(SNP4)SNPs(no amino acid change)locate in loop C,loop C,and the

seventh transmembrane domain(TM),respectively.

155

Y.Dang et al./Gene540(2014)153–160

for CC allele,and three fragments (264,236and 28bp)for CT allele (Fig.3b).At the third SNP locus,SNP3,the 197bp PCR products digested by Taq Ιdemonstrated one fragment (197bp)for CC allele,two frag-ments (170and 27bp)for TT and three fragment (197,170and 27bp)for CT allele (Fig.3c).As for the last SNP locus,SNP4,497bp prod-ucts were digested by Taq Ι,the TT allele showed one fragment (497bp),the CC allele showed two fragments (350and 147bp),while the CT al-lele showed 3fragments (497,350and 147bp,Fig.3d).Although the 33bp fragment in Fig.3a,the 28bp fragment in Fig.3b and the 27bp fragment in Fig.3c were too short to be identi ?ed clearly,the rest frag-ments were enough to identify certain genotype at the four mutation loci.

3.2.Population genetic analyses

As shown in Table 3,the frequency of both allele A and allele G in SNP1was 0.5.The frequency of allele C in both SNP2and SNP3loci was 0.89,which was a dominant ratio while the frequency of allele T in both mutation loci was 0.11.As for both SNP2and SNP3,the TT geno-type accounted for only 1%in the whole population.

The genotype frequency and allele frequency of the ?rst three loci were in Hardy –Weinberg equilibrium (P N 0.05),while the last locus was in Hardy –Weinberg disequilibrium (P b 0.05).According to the PIC values of the four mutation loci,SNP1and SNP4had moderate ge-netic diversity,while SNP2and SNP3had low genetic diversity (PIC value b 0.25,low genetic diversity;0.25b PIC value b 0.50,intermediate genetic diversity;and PIC value N 0.50,high genetic diversity).

The linkage disequilibrium analysis was done with SHEsis,SNP2and SNP3loci showed a strong linkage while the rest of the locus –locus

combinations demonstrated weak linkage (Fig.4,Table 4).There were totally 14haplotypes found in the studied population.Haplotypes with frequency higher than 3%were used for subsequent analysis.Hap-lotype structure analysis of the NPC1gene in Qinchuan cattle population was shown in Table 5.There were 980haplotypes detected in the whole population.Among the 980haplotypes,frequencies of the most com-mon haplotype (H5:GCCC)and the least common (H4:ATTT)were 29.5%and 4%,respectively.

3.3.Association analyses of cSNPs with body size traits of Qinchuan cattle As shown in Table 6,in the 2.0-year-old Qinchuan population,there was no demonstrable effect of the genotype on body size traits found at the ?rst three loci (P N 0.05).At the SNP4locus,the T allele was the wild type while the C allele was the mutant type.The body weight value of TT genotype was about higher than that of CC genotype (P b 0.05),while the heterozygous genotype CT had an intermediate body weight value.Effect size caused by SNP4was 3.0%.

As for the 3.5-year-old Qinchuan population,at SNP1locus,the AG and GG genotype individuals had bigger heart girth (P b 0.01),larger hip width (P b 0.05)and greater body weight (P b 0.01)than those of AA genotype.As for SNP1locus,G allele was the wild type and A allele was the mutant type.Effect size caused by SNP1to heart girth,hip width and body weight was 5.1%,4.1%and 6.3%,respectively.Referring to SNP2and SNP3loci,C allele was the wild type and T allele was the mutant type.Individuals with CT genotype had bigger hip width than that of CC individuals (P b 0.05).As with hip width trait,effect size caused by SNP2was 4.7%.The same with SNP2,effect size caused by

Table 2

Genetic variants identi ?ed in the bovine NPC1gene.Loci a MLG b VR c MLP d Mutation type DPS (nt)e

Sequence of primers (used for genotype identi ?cation)Tm (°C)SAF (bp)f SNP1g.G10710A Exon 2E49K Missense 0GATAAGAGATACAACTGCAGATATTCTGGGCCACTA 66.592GCCCAAGATTACTCACTCACCTGCACAAGG SNP2g.C21992T Exon 8H398H Synonymous 11,282

CGCCTGGAGAAGGAGTTCTTTGACACGTA 66.3264TAAACCATCACACTCAGCC SNP3g.C22007T Exon 8F403F Synonymous 15TGAGGCACCCCGGCTGTGT

66.8197GGCCCTGATGATGAGCTGCTCGGTTCG SNP4

g.T36976C

Exon 15

I770I

Synonymous

14,969

CCTCGTGTTCATCCGTG 56.0

497

AGAAGGCAGGTGACGAGT

a SNP loci,SNP1,g.G10710A;SNP2,g.C21992T;SNP3,g.C22007T;SNP4,g.T36976C.

b MLG,mutation location in NCP1gene sequence (GenBank Accession No.NM_174758).

c VR,variation region,all SNP loci were locate

d in exons.d MLP,mutation location in NPC1protein sequence.

e DPS,distance from previous SNP (nt).f

SAF,size of ampli ?cation

fragment.

Fig.3.The electrophoresis patterns of PCR –RFLP analysis at four SNP loci in the bovine NPC1gene.(a)Digestion result by restriction enzyme Xsp Ιat SNP1locus,g.G10710A.(b)Digestion result by restriction enzyme Rsa Ιat SNP2locus,g.C21992T.(c)Digestion result by restriction enzyme Taq Ιat SNP3locus,g.C22007T.(d)Digestion result by restriction enzyme Taq Ιat SNP4locus,g.T36976C.

156

Y.Dang et al./Gene 540(2014)153–160

SNP3to hip width trait was 4.7%,either.At SNP4locus,each genotype had no signi ?cant effects on body size traits (P N 0.05,Table 6).

In addition,the 4cSNPs showed no signi ?cant association with the other 7body size traits (Tables S1,S2).

3.4.Association analyses of combined haplotype with body size traits of Qinchuan cattle

There were 16combined haplotypes found in the 2.0-year-old pop-ulation.Each combined haplotype had no signi ?cant different effects on body size traits (P N 0.05,Table S3).

There were also 16combined haplotypes found in the 3.5-year-old population,including 15combined haplotypes the same as those in the 2.0-year-old population and a new one (Table 7).The combined haplotype H 2H 6,H 3H 5,H 6H 6and H 1H 6had bigger heart girth than that of the H 1H 2(P b 0.01).The heart girth value of combined haplotype H 6H 6and H 2H 6were bigger than that of H 2H 2(P b 0.01).The heart girth value of combined haplotype H 2H 6was bigger than that of H 1H 1,H 1H 5and H 5H 5(P b 0.01).The combined haplotype H 2H 6had the big-gest heart girth while the H 1H 2had the smallest heart girth.The hip

width value of combined haplotype H 2H 6,H 3H 5,H 5H 5,and H 6H 6was bigger than that of H 2H 2(P b 0.01),the combined haplotype H 1H 5and H 1H 6had bigger hip width than that of H 2H 2(P b 0.05),the combined haplotype H 2H 6,H 3H 5and H 6H 6had bigger hip width than that of H 1H 1and H 1H 2(P b 0.05).The hip width value of combined haplotype H 3H 5was the biggest while the H 2H 2had the smallest hip width.The combined haplotype H 1H 6,H 2H 6,H 3H 5,H 5H 5and H 6H 6had heavier body weight than that of H 1H 2(P b 0.01),the combined haplotype H 2H 6and H 6H 6had heavier body weight than that of H 2H 2(P b 0.01),while the body weight value of combined haplotype H 2H 6was bigger than that of H 1H 1and H 1H 5(P b 0.01).The body weight value of com-bined haplotype H 2H 6was the biggest value while the body weight value of H 1H 2was the smallest.Referring to heart girth,hip width and body size traits,effect size caused by the 16combined haplotypes was 6.2%,6.0%and 8.4%,respectively.

In addition,no signi ?cant association was found between the com-bined haplotypes and the other 7body size traits (Tables S3,S4).4.Discussion

In this study,we have detected four novel mutations in NPC1exons (SNP1:g.10710G N A;SNP2:g.21992C N T;SNP3:g.22007C N T;and SNP4:g.36976T N C.)and revealed their associations with body size traits in Chinese Qinchuan cattle.

All the mutations found in this study were located in exons which are important functional DNA regions.The ?rst SNP (g.G10710A)is a missense mutation located in Loop A region (Fig.2),causing the amino acid Glu to mutate into Lys.Glu is an acidic amino acid while Lys is a basic amino acid.The two amino acids have entirely different electric properties which may lead to different functions of the protein.A missense mutation (D298E)in melanocortin 4receptor (MC4R)was associated with fatter,higher-feed consuming,and faster-growing ani-mals (Kim et al.,2000).A missense mutation in the bioactive part of the GDF9protein showed strong association with litter size in Norwe-gian White Sheep (V?ge et al.,2013).A missense mutation (R431L)in the IGF-I receptor L2domain leads to the inhibition of cell proliferation,

Table 3

Population genetic analyses of bovine NPC1gene in Qinchuan cattle.Loci a Genotype/number/genotype frequency Allele/allelic frequency χ2(HWE)b H e c H o d Ne e PIC f SNP1AA/135/0.27AG/247/0.48GG/130/0.25A/0.50G/0.500.67?0.480.52 2.000.375SNP2CC/397/0.79CT/98/0.20TT/7/0.01C/0.89T/0.110.13?0.800.20 1.250.179SNP3CC/408/0.79CT/102/0.20TT/6/0.01C/0.89T/0.110.01?0.800.20 1.250.177SNP4

CC/233/0.46

CT/108/0.22

TT/161/0.32

C/0.57

T/0.43

158.39??

0.51

0.49

1.96

0.370

a SNP loci,SNP1,g.G10710A;SNP2,g.C21992T;SNP3,g.C22007T;SNP4,g.T36976C.b

χ2(HWE):Hardy –Weinberg equilibrium χ2value.c

H e ,stands for heterozygosity of NPC1gene.d

H o ,stands for homozygosity of NPC1gene.e

Ne,effective allele numbers.f

Polymorphism information content.

?Hardy –Weinberg equilibrium (P N 0.05).??Hardy –Weinberg disequilibrium (P b 0.05).

Table 4

Pair-wise LD analysis of the four SNP loci.Loci a

Qinchuan cattle r 2

SNP1–SNP20.072SNP1–SNP30.091SNP1–SNP40.003SNP2–SNP30.806SNP2–SNP40.000SNP3–SNP40.000Mean

0.162

a

SNP loci,SNP1,g.G10710A;SNP2,g.C21992T;SNP3,g.C22007T;SNP4,

g.T36976C.

Fig.4.Pair-wise linkage disequilibrium (LD)tests of four cSNPs based on r 2,the deep color denotes strong linkage between two loci.

157

Y.Dang et al./Gene 540(2014)153–160

attenuation of IGF signaling and decrease in internalization of IGF-IR (Kawashima et al.,2012).Data in Table6showed the effects of the sin-gle cSNPs on body size traits in Qinchuan cattle.For SNP1locus,individ-uals with genotype AG or GG have higher heart girth,wider hip width and heavier body weight than those of the mutation type AA.As the binding site of sterols has been determined to be a soluble N-terminal domain(NTD,Loop A region,Fig.2,Infante et al.,2008),the AA variants might exert functionally distinct abilities in the regulation of lipid trans-portation which result in different heart girth,hip width and body weight.

While synonymous mutations also play an important role in gene expression.The other three SNPs(SNP2,g.C21992T;SNP3,g.C22007T; SNP4,g.T36976C)are synonymous mutations with no amino acid change.Because of this,synonymous mutations were also called silent mutations.Although it does not affect the?nal protein sequence,it may cause a certain in?uence on the transcription process.Evidences show that synonymous sites do not evolve neutrally,at least in part owing to selection on mRNA stability(Chamary and Hurst,2005). Naturally occurring silent SNPs can affect in vivo protein folding and, consequently,function.The study shows that substrate speci?city of P-glycoprotein,the product of the multidrug resistance1(MDR1) gene,is altered by SNPs presumed to be synonymous and silent (Komar,2007).Two synonymous mutations in the bovine NUCB2 gene had signi?cant effects on body length,body weight,heart girth, and average daily gain(Li et al.,2010).In this study,for the second and third SNPs(3.5-year-old,Table6),the CT individuals had bigger hip width than the CC individuals,which indicates that the mu-tation in the two loci can help increase hip width.For the fourth loci (2.0-year-old,Table6),the TT individuals tended to have heavier body weight than that of CC ones,which indicates that the mutation in the fourth loci may help decrease body weight.So,the association analysis between synonymous mutations and body size traits in this study may provide more evidence for studying the potential function of silent mutations in the bovine NPC1gene.

Evidences show that the effect of some genes on body size traits may be stage-speci?c.Statistical analyses indicated that the SNPs1,4,and5 of BMP7gene are associated with the body weight,body length,and heart girth at12and24months(P b0.05)while no signi?cant effect at6and18months in Nanyang cattle population(Huang et al.,2013). The different effects that the four cSNPs showed on body size traits in the two different age groups may be due to the different roles of the NPC1gene in different development periods.The effect that the NPC1 gene may have on body size traits may be a long process and needs more studies to testify.

SNP2and SNP3loci showed a strong linkage while the rest of the locus–locus combinations demonstrated weak linkage.So,it is neces-sary to have combined haplotypes associate to supply more useful https://www.360docs.net/doc/0917657796.html,bined haplotypes are,sometimes,more reliable than single-marker analysis for genetic disease and trait associations,due to the ancestral structure captured in the distribution of haplotypes (Akey et al.,2001;Schaid,2004).An analysis based on haplotypes can be advantageous over an analysis based on individual SNPs in the presence of multiple susceptibility alleles,particularly when linkage dis-equilibrium between SNPs is weak(Morris and Kaplan,2002).

Based on Tables6and7,consistent with the effect of SNP1,com-bined haplotypes show signi?cant effect on heart girth,hip width and body weight in the3.5-year-old population.While the effect of com-bined haplotypes is not the same with that of SNP2,SNP3and SNP4, which indicated that SNP2,SNP3and SNP4may be in?uenced by SNP1.This might be similar to the SNPs of the BMP7gene having signif-icant effect on body size traits such as body length,heart girth and body weight,while the combined haplotypes of BMP7gene SNPs having no signi?cant effect on the body size traits(Huang et al.,2013).So,

Table5

Haplotypes of bovine NPC1gene in Qinchuan cattle.

Haplotype Loci a Frequency

SNP1SNP2SNP3SNP4

H1(ACCC)b A C C C0.211

H2(ACCT)b A C C T0.178

H3(ATTC)b A T T C0.054

H4(ATTT)b A T T T0.040

H5(GCCC)b G C C C0.295

H6(GCCT)b G C C T0.197

a SNP loci,SNP1,g.G10710A;SNP2,g.C21992T;SNP3,g.C22007T;SNP4,g.T36976C.

b Frequency larger than3%can be used for subsequent analysis.

Table6

Effects of SNPs on body size traits in Qinchuan cattle.

Loci#Body size traits(Mean±SE)

2.0-year-old

3.5-year-old

G F Heart girth(cm)Hip width(cm)Body weight(kg)G F Heart girth(cm)Hip width(cm)Body weight(kg)

SNP1AA0.23174.23±1.6041.90±0.38382.23±9.48AA0.32183.10±1.51B43.08±0.65b436.49±8.91B AG0.49173.64±1.1341.66±0.39377.91±7.68AG0.46189.72±1.52A44.90±0.54a474.92±8.99A GG0.28173.03±1.5141.25±0.51374.90±10.50GG0.22190.29±2.22A45.65±0.92a484.90±13.50A P-value0.8640.6440.884P-value0.006(P b0.01)0.033(P b0.05)0.004(P b0.01) Effect size(%)Δ0.20.50.1Effect size(%)Δ 5.1 4.1 6.3

SNP2CC0.83173.65±0.8841.54±0.29378.67±5.99CC0.77187.17±1.2343.92±0.46b461.02±7.27 CT0.16173.02±1.8341.82±0.54372.26±10.18CT0.22189.26±1.6346.21±0.63a476.43±10.18 TT0.01*–––TT0.01*–––P-value0.7280.7690.657P-value0.5140.028(P b0.05)0.507 Effect size(%)Δ0.00.20.0Effect size(%)Δ0.8 4.70.9

SNP3CC0.83173.65±0.8741.52±0.29378.84±6.00CC0.77187.17±1.2343.92±0.46b461.02±7.27 CT0.15173.75±1.9441.92±0.57375.77±10.30CT0.22189.26±1.6346.21±0.63a476.43±10.18 TT0.02*–––TT0.01*–––

P-value0.00.30.1P-value0.5140.028(P b0.05)0.507

Effect size(%)Δ0.00.30.1Effect size(%)Δ0.8 4.70.9

SNP4CC0.43172.61±10.9141.39±0.44368.44±8.03b CC0.45186.75±1.3844.35±0.53458.28±8.16 CT0.24172.18±9.6541.60±0.43370.24±10.11ab CT0.23186.13±2.0044.54±0.79454.61±11.72 TT0.32176.01±9.7041.89±0.40396.85±8.97a TT0.32190.26±2.0244.63±0.77481.35±12.12 P-value0.1030.6910.044(P b0.05)P-value0.2220.9480.165

Effect size(%)Δ 1.90.4 3.0Effect size(%)Δ 1.30.1 1.6

Note:#,SNP loci,SNP1,g.G10710A;SNP2,g.C21992T;SNP3,g.C22007T;SNP4,g.T36976C.

a and

b denote values that differ signi?cantly at P b0.05,A and B denote values that differ signi?cantly at P b0.01.

*Denote that the body traits of genotypic frequency less than5%cannot be used.

Δ,percentage of phenotypic variance explained by each genotype.

158Y.Dang et al./Gene540(2014)153–160

maybe SNP1of the NPC1gene in this study may play a dominant role in the effect that NPC1gene has on body size traits of Qinchuan cattle.But,haplotypes can be population-speci ?c due to the population's ancestry and demography (Neale and Sham,2004;Weiss and Clark,2002).Thus,more work including increasing sample size and cattle breeds should be done in the future to ?nd more connections and mutual ef-fects between the NPC1gene and body size traits in cattle.

With the fast development of the Chinese economy and the great improvement of the living standard of the Chinese people,demands for beef consumption are growing.Beef cattle with rapid growth and ?avorous taste is becoming an urgent demand.Our research can help to select the fast growing beef cattle in the process of breeding in beef cattle industry.

5.Conclusion

We ?rst reported the genetic variations of the NPC1gene in Chinese Qinchuan cattle,and evaluated their association with 10major body size traits in Qinchuan cattle.Several important variations and com-bined haplotypes associated with body size traits were found.Our in-vestigation has determined that mutations in the NPC1gene,which is related to human obesity and NPC disease,are associated with body size of the Chinese Qinchuan cattle.Furthermore,our ?ndings will also provide constructive and valuable information for the marker assisted selection in beef cattle breeding industry.

Con ?ict of interest

We declare that we have no con ?ict of interest.

Acknowledgments

This study was supported by the National 863Program of China (Grant No.2013AA102505),National Natural Science Foundation of China (Grant No.31272408),Program of National Beef Cattle and Yak Industrial Technology System (CARS-38),and Agricultural Science and Technology Innovation Projects of Shaanxi Province (No.2012NKC01-13).

Appendix A.Supplementary data

Supplementary data to this article can be found online at https://www.360docs.net/doc/0917657796.html,/10.1016/j.gene.2014.03.001.

References

Akey,J.,et al.,2001.Haplotypes vs single marker linkage disequilibrium tests:what do we

gain?European Journal of Human Genetics 9(4),291–300.

Botstein,D.,et al.,1980.Construction of a genetic linkage map in man using restric-tion fragment length polymorphisms.American Journal of Human Genetics 32(3),314.

Brown,M.S.,Goldstein,J.L.,1986.A receptor-mediated pathway for cholesterol homeo-stasis.Science 232(4746),34–47.

Chamary,J.,Hurst,L.D.,2005.Evidence for selection on synonymous mutations affecting

stability of mRNA secondary structure in mammals.Genome Biology 6(9),R75.Davies,J.P.,Ioannou,Y.A.,2000.Topological analysis of Niemann –Pick C1protein reveals

that the membrane orientation of the putative sterol-sensing domain is identical to those of 3-hydroxy-3-methylglutaryl-CoA reductase and sterol regulatory element binding protein cleavage-activating protein.Journal of Biological Chemistry 275(32),24367–24374.

Def ?eu,M.S.,Pfeffer,S.R.,2011.Niemann –Pick type C 1function requires lumenal domain

residues that mediate cholesterol-dependent NPC2binding.Proceedings of the Na-tional Academy of Sciences of the United States of America 108(47),18932–18936.Durrant,C.,et al.,2004.Linkage disequilibrium mapping via cladistic analysis of single-nucleotide polymorphism haplotypes.American Journal of Human Genetics 75(1),35–43.

Gilbert,R.P.,et al.,1993.Linear body measurements of cattle before and after 20years of

selection for postweaning gain when fed two different diets.Journal of Animal Sci-ence 71(7),1712–1720.

Henderson,C.,1986.Estimation of variances in animal model and reduced animal model

for single traits and single records.Journal of Dairy Science 69(5),1394–1402.

Huang,Y.-Z.,et al.,2011.Haplotype combination of SREBP-1c gene sequence variants is

associated with growth traits in cattle.Genome 54(6),507–516.

Huang,Y.Z.,et al.,2013.Identi ?cation and genetic effect of haplotype in the bovine BMP7

gene.Gene 532(2),281–287.

Infante,R.E.,et al.,2008.Puri ?ed NPC1protein I.Binding of cholesterol and oxysterols to a

1278-amino acid membrane protein.Journal of Biological Chemistry 283(2),1052–1063.

Kawashima,Y.,et al.,2012.Novel missense mutation in the IGF-I receptor L2domain re-sults in intrauterine and postnatal growth retardation.Clinical Endocrinology 77(2),246–254.

Kim,K.S.,et al.,2000.A missense variant of the porcine melanocortin-4receptor (MC4R)

gene is associated with fatness,growth,and feed intake traits.Mammalian Genome 11(2),131–135.

Komar,A.A.,2007.SNPs,silent but not invisible.DNA 5,3.

Lewontin,R.,1988.On measures of gametic disequilibrium.Genetics 120(3),849–852.Li,F.,et al.,2010.Novel SNPs of the bovine NUCB2gene and their association with growth

traits in three native Chinese cattle breeds.Molecular Biology Reports 37(1),541–546.

Louwette,S.,et al.,2013.NPC1defect results in abnormal platelet formation and function:

studies in Niemann –Pick disease type C1patients and zebra ?sh.Human Molecular Genetics 22(1),61–73.

Meyre,D.,et al.,2009.Genome-wide association study for early-onset and morbid adult

obesity identi ?es three new risk loci in European populations.Nature Genetics 41(2),157–159.

Morris,R.W.,Kaplan,N.L.,2002.On the advantage of haplotype analysis in the presence of

multiple disease susceptibility alleles.Genetic Epidemiology 23(3),221–233.

Morris,J.A.,et al.,1999.The genomic organization and polymorphism analysis of the

human Niemann –Pick C1gene.Biochemical and Biophysical Research Communica-tions 261(2),493–498.

Neale,B.M.,Sham,P.C.,2004.The future of association studies:gene-based analysis and

replication.The American Journal of Human Genetics 75(3),353–362.

Nei,M.,1973.Analysis of gene diversity in subdivided populations.Proceedings of the Na-tional Academy of Sciences 70(12),3321–3323.

Table 7

Association analyses of combined haplotypes with body size traits in Qinchuan cattle (3.5-year-old).CH*

Genotype

F #

Body size traits (Mean ±SE)Heart girth (cm)

Hip width (cm)Body weight (kg)H 1H 1AACCCCCC 0.06182.78±3.24BCD

41.44±1.26ABbc

428.61±16.00BCD H 1H 2AACCCCCT 0.05173.81±3.47D 41.50±1.16ABbc 385.43±15.53D H 1H 5AGCCCCCC 0.18185.39±2.37BCD 43.85±0.81ABab 446.40±13.74BCD H 1H 6AGCCCCCT 0.08189.08±3.49ABC 43.58±1.47ABab 471.78±21.78ABC H 2H 2AACCCCTT 0.07179.41±2.07CD 39.82±1.28Bc 418.94±14.36CD H 2H 6AGCCCCTT 0.10196.56±3.71A 46.06±1.20Aa 511.83±22.37A H 3H 5AGCTCTCC 0.05192.00±3.34ABC 46.71±1.65Aa 496.70±15.54ABC H 5H 5GGCCCCCC 0.11187.76±2.76BCD 45.06±1.13Aab 468.43±15.54ABC H 6H 6GGCCCCTT

0.08

194.08±4.26AB 46.54±1.72Aa 505.87±24.64AB P-value

0.004(P b 0.01)0.007(P b 0.01)0.004(P b 0.01)Effect size (%)Δ

6.2

6.0

8.4

Note:*,CH,combined haplotypes.

#,F,frequency in the studied Qinchuan cattle population,those less than 5%was abandoned.a –c denote values that differ signi ?cantly at P b 0.05.A –D denote values that differ signi ?cantly at P b 0.01.

Δ,percentage of phenotypic variance explained by each combined haplotypes.

159

Y.Dang et al./Gene 540(2014)153–160

Ohgane,K.,et al.,2013.Discovery of oxysterol-derived pharmacological chaperones for NPC1:implication for the existence of second sterol-binding site.Chemistry and Biol-ogy20(3),391–402.

Pentchev,P.G.,2004.Niemann–Pick C research from mouse to gene.Biochimica et Biophysica Acta(BBA)—Molecular and Cell Biology of Lipids1685(1),3–7. Sambrook,J.,et al.,2001.Molecular Cloning:A Laboratory Manual(3-volume Set). Schaid,D.J.,2004.Evaluating associations of haplotypes with traits.Genetic Epidemiology 27(4),348–364.

Scott,C.,Ioannou,Y.A.,2004.The NPC1protein:structure implies function.Biochimica et Biophysica Acta1685(1–3),8–13.

Scriver,C.R.,2001.The Metabolic&Molecular Bases of Inherited Disease.McGraw-Hill. Sleat,D.E.,et al.,2004.Genetic evidence for nonredundant functional cooperativity be-tween NPC1and NPC2in lipid transport.Proceedings of the National Academy of Sci-ences of the United States of America101(16),5886–5891.

V?ge,D.I.,et al.,2013.A missense mutation in growth differentiation factor9(GDF9)is strongly associated with litter size in sheep.BMC Genetics14(1),1.van der Kant,R.,et al.,2013.Cholesterol binding molecules MLN64and ORP1L mark dis-tinct late endosomes with transporters ABCA3and NPC1.Journal of Lipid Research54

(8),2153–2165.

Weiss,K.M.,Clark,A.G.,2002.Linkage disequilibrium and the mapping of complex human traits.Trends in Genetics18(1),19–24.

Xie,C.,et al.,1999.Cholesterol balance and metabolism in mice with loss of function of Niemann–Pick C protein.American Journal of Physiology.Endocrinology and Metab-olism276(2),E336–E344.

Yeh,F.,1997.Population genetic analysis of codominant and dominant markers and quantitative traits.Belgian Journal of Botany129,157.

Yong,Y.,Lin,H.,2005.SHEsis,a powerful software platform for analyses of linkage dis-equilibrium,haplotype construction,and genetic association at polymorphism loci.

Cell Research15(2),97–98.

Zimin,A.V.,et al.,2009.A whole-genome assembly of the domestic cow,Bos taurus.

Genome Biology10(4),R42.

160Y.Dang et al./Gene540(2014)153–160