LH and FSH 斑马鱼

Genetic Analysis of Zebrafish Gonadotropin(FSH and LH)Functions by TALEN-Mediated Gene Disruption Zhiwei Zhang,Bo Zhu,and Wei Ge

School of Life Sciences(Z.Z.,B.Z.,W.G.),The Chinese University of Hong Kong,Shatin,New Territories,Hong Kong,China;and Faculty of Health Sciences(Z.Z.,W.G.),University of Macau,Taipa,Macau,China

Vertebrate reproduction is controlled by two gonadotropins(FSH and LH)from the pituitary. Despite numerous studies on FSH and LH in fish species,their functions in reproduction still remain poorly defined.This is partly due to the lack of powerful genetic approaches for functional studies in adult fish.This situation is now changing with the emergence of genome-editing technologies, especially Transcription Activator-Like Effector Nuclease(TALEN)and Clustered Regularly Inter-spaced Short Palindromic Repeats(CRISPR).In this study,we deleted the hormone-specific?-genes of both FSH and LH in the zebrafish using TALEN.This was followed by a phenotype analysis for key reproductive events,including gonadal differentiation,puberty onset,gametogenesis,final maturation,and fertility.FSH-deficient zebrafish(fshb?/?)were surprisingly fertile in both sexes; however,the development of both the ovary and testis was significantly delayed.In contrast,LH-deficient zebrafish(lhb?/?)showed normal gonadal growth,but the females failed to spawn and were therefore https://www.360docs.net/doc/3c2301675.html,ing previtellogenic follicles as the marker,we observed a significant delay of puberty onset in the fshb mutant but not the lhb mutant females.Interestingly,FSH seemed to play a role in maintaining the female status because we repeatedly observed sexual reversal in the fshb mutant.Neither the fshb nor lhb mutation alone seemed to affect gonadal differentiation;however, the double mutation of the two genes led to all males,although the development of the testis was significantly delayed.In summary,our data confirmed some well-known functions of FSH and LH in fish while also providing evidence for novel functions,which would be difficult to reveal using tradi-tional biochemical and physiological approaches.(Molecular Endocrinology29:76–98,2015)

I n vertebrates,reproduction is controlled by two master gonadotrophic hormones from the pituitary gland,FSH and LH.Both gonadotropins belong to the glycoprotein hormone family,consisting of one common?-subunit and one hormone-specific?-subunit(1).In mammals, FSH and LH have been extensively studied,and their functions are clearly defined.FSH stimulates follicular growth and estrogen production by binding to its cognate receptor FSH receptor(FSHR)located on the granulosa cells in the ovary and promotes spermatogenesis in the testis by activating FSHR expressed in the Sertoli cells.On the other hand,LH stimulates androgen production by the theca cells in the ovary,providing a substrate for estrogen production in the granulosa cells,and triggers oocyte maturation and ovulation.

In the testis,LH stimulates androgen production by the Leydig cells(2,3).The clear definition of FSH and LH in mammals has benefited greatly from genetic approaches or gene knockouts in the mouse.In the FSH?-gene knockout(KO)mouse,the mutant females are infertile due to a blockade in folliculogenesis prior to antral follicle formation.However,FSH-deficient males are fertile de-spite having smaller testes and oligospermia(4).In con-trast,the deletion of the LH?-gene causes infertility in both males and females.LH-deficient females have de-fects in folliculogenesis including the degeneration of an-

ISSN Print0888-8809ISSN Online1944-9917

Printed in U.S.A.

Copyright?2015by the Endocrine Society

Received August14,2014.Accepted November11,2014. First Published Online November14,2014Abbreviations:BW,body weight;CRISPR/Cas9,Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated system;dpf,days post fertilization;EV,early vitel-logenic;FG,full grown;FSHR,FSH receptor;gDNA,genomic DNA;GSI,gonadosomatic index;HMA,heteroduplex motility assay;HRMA,high-resolution melt analysis;KO, knockout;PG,primary growth stage;PV,previtellogenic;qPCR,quantitative PCR;RT, reverse transcription;RVD,repeat variable diresidue;SL,standard length;TALEN,Tran-scription Activator-Like Effector Nuclease;WT,wild type.

O R I G I N A L R E S E A R C H

https://www.360docs.net/doc/3c2301675.html, Mol Endocrinol,January2015,29(1):76–98doi:10.1210/me.2014-1256

tral follicles and absence of corpora lutea in the ovary.In males,the lack of LH leads to a decreased testis size, hypoplasia of Leydig cells,blockade of spermatogenesis at the round spermatid stage,and reduced expression of steroidogenic enzymes and secretion of T(5).

In teleosts,the understanding of gonadotropins has taken a long journey,and our knowledge about their functions still remains rudimentary.Although it has been known for many decades in mammals that the pituitary gland produces two gonadotropins since the first report in1931on the follicle-stimulating and luteinizing fractions in the pituitary(6),it was believed for a long time that gonadal development and function in fish were controlled by one single gonadotropin (7–9).The concept of two gonadotropins was proposed later after the mid-1970s based on histochemical and bio-chemical evidence(10–13),but the chemical nature of the molecules was not defined until1988when two chemically distinct gonadotropins,termed GTH-I and GTH-II,were characterized in the chum salmon(Oncorhynchus keta) (14).Ever since then,there have been numerous studies in teleosts demonstrating the duality of gonadotropins,and structural and functional studies have led to the proposal that GTH-I and GTH-II should be renamed to FSH and LH, respectively(15,16).According to the GenBank record in 2014,gonadotropins(FSH and LH)have been sequenced in more than70teleost species.Although the number of fish species whose gonadotropins have been characterized is in-creasing,one major issue that concerns most in the field is the differential functions of the two hormones.

Numerous studies have been reported in a variety of fish species on the physiological roles of FSH and LH(17)and their regulation(18);however,our knowledge of FSH and LH functions still remains fragmentary.It is now generally believed that similar to their mammalian counterparts,fish FSH is mostly involved in promoting early gonadal develop-ment and growth,whereas LH plays an important role in regulating the late stage of gametogenesis,including the final gamete maturation and release(ovulation and spermiation) (19,20).Most studies on gonadotropin functions have been focused on their expression profiles during the reproductive cycles at the transcript and/or protein levels(21–28),effects on gonadal steroidogenesis in males and females(29–34),vitello-genesis in females(35),and final gamete maturation(36–40).

In the zebrafish,our previous studies have shown that different from the gonadotropins in tetrapods,zebrafish FSH and LH show promiscuous recognition of gonadotro-pin receptors(Fshr/fshr and Lhcgr/lhcgr).Recombinant ze-brafish FSH specifically activates its cognitive receptor Fshr expressed in Chinese hamster ovary cells;however,ze-brafish LH can activate both Fshr and Lhcgr although the activation of Fshr requires higher concentrations of ze-brafish LH compared with its activation of Lhcgr(41).A similar phenomenon has also been observed in some other species such as the African catfish(Clarias gariepinus)(28) and Senegalese sole(Solea senegalensis)(31).The physiolog-ical relevance of activating Fshr by LH remains mysterious. Although the expression profiles of zebrafish FSH and LH ?-genes(fshb and lhb)during the reproductive cycle are not fully clear(41),our previous study on their receptors,fshr and lhcgr,has provided strong evidence for their differential roles in controlling folliculogenesis in females(42).Both fshr and lhcgr have a very low expression in the follicles of the primary growth stage(PG).However,the expression of fshr but not lhcgr increases significantly when the follicles are recruited into the secondary growth stage,and its level re-mains high throughout vitellogenic growth before it drops prior to final oocyte maturation.In contrast,the expression of lhcgr starts to increase in late vitellogenic follicles,and its level surges to the peak at the full-grown(FG)stage before oocyte maturation(42,43).

Table1.Primers Used for Genotyping,RT-PCR,and Sequencing

Gene Primer Name Primer Sequence(5-?–3-?)Application

fshb Fshb_1666(P1)AGATGAGGATGCGTGTGCTT HRMA

fshb_1667(P2)GATGGAGATGTTTGTGAGTCG

fshb_1794(P3)TTGTTCTGGCGCTGCTGTTGC RT-PCR

fshb_1795(P4)TTCTGGGTGTGCTGTGCCAT

fshb_1685ATTGCTGTATTGGCTGCACT Sequencing

fshb_1686CACAGATGAAAAGGACACACG

lhb lhb_1672(P1)GGATGTTATTGGCTGGAAATG HRMA

lhb_1717(P2)AGCGTGGAAAAACCAAGCTC

lhb_1797(P3)GGTGTCTTCTTTCTCTTCTC RT-PCR

lhb_1798(P4)CGGGCTCTTGTAAACGGGAT

lhb_1691GGATGTTATTGGCTGGAAATG Sequencing

lhb_1692CAGTGGGGGAAATCAGAGCAC

Lhb_184ATGTTATTGGCTGGAAATGG Real-time qPCR

Lhb_185CTAGTATGCGGGGAAATCC

ef1a ef1a_728GGCTGACTGTGCTGTGCTGATTG RT-PCR

ef1a_729CTTGTCGGTGGGACGGCTAGG Real-time qPCR

doi:10.1210/https://www.360docs.net/doc/3c2301675.html,77

Despite all these studies,our understanding of FSH and LH,especially their relative importance in controlling gonadal development and functions,still remains limited as compared with studies in mammals.This is largely due to the lack of pure forms of homologous hormones with biological activity,the international standard of bioas-says,and more importantly the genetic or knockout ap-proach available in the mouse model.This situation has changed recently with the emergence of powerful ge-nome-editing technologies,in particular the Transcrip-tion Activator-Like Effector Nuclease(TALEN)and Clustered Regularly Interspaced Short Palindromic Re-peats/CRISPR-associated system(CRISPR/Cas9)(13).

Both TALEN(44–46)and CRISPR/Cas9(47–49) have been successfully adopted in the zebrafish model to disrupt functional genes.TALEN was first used in the zebrafish to delete the genes golden,ryr3,tbx6,and ryr1a (44),whereas CRISPR/Cas9has been shown to be equally efficient to induce gene disruption in the zebrafish(48). However,all studies reported so far in the zebrafish have aimed at demonstrating the utility of the technologies with phenotypes mostly restricted to the embryonic stages.There has been no report studying functions of genes in adults using these technologies in the zebrafish.

To provide genetic evidence for the function and physio-logical significance of the two gonadotropins in teleosts,we have undertaken the present study by using TALEN ap-proach to disrupt zebrafish FSH and LH?-genes(fshb and lhb).This was followed by a detailed analysis of reproduc-tive phenotypes in both females and males.Our analysis focused on several important events in reproductive devel-opment and function,including gonadal differentiation,pu-berty onset,gametogenesis,final maturation,and fertility. The results from the present study have,for the first time, provided the most comprehensive genetic evidence for go-nadotropin functions in a teleost species.Our data not only confirmed some well-established functions of FSH and LH but also revised some views.More importantly,we have provided evidence for novel functions of these hormones that would be difficult to reveal using traditional biochem-ical and physiological approaches.

Materials and Methods

Zebrafish

The wild type(WT)zebrafish of strain AB was used in the present study to produce mutant lines.Zebrafish were main-tained in flow-through aquaria at28?0.5°C with the photo-period of14hours light and10hours dark.All the experiments performed were licensed by the Government of the Hong Kong Special Administrative Region and were approved by the Ani-mal Experimentation Ethics Committee of the Chinese Univer-sity of Hong Kong.

TALEN design and assembly

The specific TALEN target sites were identified using an online tool(TAL Effector-Nucleotide Targeter:https://tale-nt. https://www.360docs.net/doc/3c2301675.html,/).The selected criteria were followed as de-scribed(44).Gene-specific TALEN constructs were assembled using the TALEN Golden Gate assembly system as described (50).The two TALEN somatic expression backbones, pCS2TAL3DD and pCS2TAL3RR(44),and the plasmids pro-viding repeat variable diresidue(RVD)repeats for Golden Gate cloning(50)were obtained from Addgene.Briefly,two rounds of Golden Gate cloning assembly were performed to generate a TALEN gene with N RVD repeat modules(N?number of RVDs).First,two arrays were generated,corresponding to re-peat modules1–10and11-N

-1

.The resulting vectors that ac-quired correct arrays were confirmed first by the size of repeat array inserts amplified by PCR with the primers flanking the insertion site and then sequencing of the plasmids.Second,the

Figure1.Schematic representation of the genomic structures of

zebrafish fshb(A)and lhb(B)genes and the target sites of TALEN.The

coding and untranslated exon regions are depicted as solid and open

boxes,respectively.The TALEN target sequence for each gene is shown

under each illustration,with the left and right TALEN binding sites

boxed.Arrows indicate the location of primers used for HRMA and the translation initiation codon(ATG)is italicized.

Table2.TALEN-Induced Mutations in F0Embryos and Adults

Gene Postinjection

Embryo Survival

Rate

Postinjection

Abnormal Embryo

Rate

Postinjection

Mutation Rate

at24hpf

Somatic

Mutation Rate

in F0Adults

Germ Line

Transmission

Rate

fshb31/60;52%3/31;10%3/10;30%6/10;60%4/20;20% lhb32/60;53%3/32;10%10/10;100%10/10;100%7/20;35% Abbreviation:hpf,hours post fertilization.Germ line mutation rate is the number of F1fish with mutations among the offspring of one F0fish.

78Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January2015,29(1):76–98

two arrays and the sequences encoding the Nth motif were sub-cloned into the backbone vectors (50).The RVD repeat array sequences were cloned into pCS2TAL3DD to generate a left TALEN arm and pCS2TAL3RR to generate a right TALEN arm.The assemblies were confirmed by sequencing.

Injection of TALEN RNA into zebrafish embryos

The 5?-capped mRNA was generated by in vitro transcrip-tion from the customized TALEN plasmid templates using the mMESSAGE and mMACHINE SP6kit (Invitrogen).The cus-tomized TALEN plasmids were linearized with Not I at 37°C for at least 3hours before in vitro transcription.One microgram of linear template was used in the reaction of in vitro transcription,and the yield of the transcribed mRNA was determined by NanoDrop 2000(Thermo Scientific).Fifty picograms of left and right TALEN mRNA each were coinjected into the cytoplasm of one-or two-cell stage zebrafish embryos using the Drummond Nanoject system (Drummon Scientific).

Genomic DNA extraction

The genomic DNA (gDNA)was obtained by the NaOH method (51).Briefly,a single embryo or piece of caudal fin was incubated in 50?L NaOH (50mM).The caudal fin was sam-pled after the fish was anesthetized with MS-222(tricaine meth-anesulphonate,250mg/L;Sigma-Aldrich).The samples were then heated to 95°C until the tissue was noticeably friable,usu-ally 10minutes for the embryo and 20minutes for the fin cut.The solution was then cooled to 4°C,and one tenth volume of 1M Tris-HCL (pH 8.0)was added to neutralize the basic solu-tion.The sample was centrifuged at 13000rpm for 2minutes,and the supernatant was ready for use in PCR.

High-resolution melt analysis (HRMA)

To detect TALEN-induced mutations by HRMA,a 90-to 120-bp amplicon that included the entire genomic target site was generated.Primers flanking the target site were used to amplify the genomic region in a 20?L PCR containing:0.5?l EvaGreen (?20),2?L PCR master mix,2?L embryonic or fin gDNA,and 400nM each forward and reverse primers (Table 1).

The amplification/duplex formation condi-tions were as follows:denaturation at 95°C for 3minutes;40cycles (denatur-ation at 95°C for 15sec;annealing at 62°C for 15sec;extension at 72°C for 20sec);denaturation at 95°C for 15sec;melt curve 70°C-95°C,with a 0.2°C in-crement each step.The amplification was performed on the Bio-Rad CFX96real-time PCR system (Bio-Rad Labo-ratories),and the HRMA analysis was carried out using the Bio-Rad Pre-cision Melt Analysis software (Bio-Rad Laboratories).

The HRMA profile for each gene can be presented as either temperature-shifted melt curve and/or melt peak.The shifted melt curve is sensitive to distin-guish heterozygous (?/?)from ho-mozygous samples (?/?or ?/?),whereas the melt peak is often a better choice to distinguish homozygous mu-tants (?/?)from homozygous wild type (?/?).When the sequence difference is less than 5bp (eg,lhb ),the melt peaks of HRMA profiles often cannot distinguish homozygous mutants (?/?)from the wild type (?/?).To solve this problem,we spiked the unknown samples with wild-type gDNA to create heterodu-plexes,which could be easily detected by either shifted curves or melt peaks.

Heteroduplex motility assay (HMA)

We performed an HMA using PAGE to confirm the mutations detected by HRMA.Briefly,a 90-to 120-bp amplicon that included the entire genomic target site was generated by using the same primers as those for HRMA.A three-step PCR was carried out:95°C for 3minutes,

40

Figure 2.HRMA detection and sequence analysis of TALEN-induced somatic mutations in fshb (A)and lhb (B)genes in F0embryos (1–2dpf).Each curve represents a single embryo.Both normalized,temperature-shifted melt curve (left panel)and melt peak (right panel)are shown.The red curve represents the uninjected control embryo,and the green ones are from the embryos injected with TANEN mRNAs.The arrow indicates the melt peak generated from the injected embryos with

potential somatic mutations.The representative TALEN-induced sequence alterations (indel,insertions and deletions)at targeted locus are shown at the bottom of each panel.Sequences in shadow indicate left and right TALEN binding sites,and red indicate sequence alterations.

doi:10.1210/https://www.360docs.net/doc/3c2301675.html, 79

cycles of95°C for15seconds,60°C for20seconds,and72°C for 20seconds.Five microliters of PCR reaction were electrophoresed on20%polyacrylamide gels at50V for at least10hours,and the gel was stained with ethidium bromide and visualized on Gel Doc XR?System(Bio-Rad Laboratories)(52).

Histological examination

All fish sampled were recorded for their body weight,standard body length,and age before processing for histological examina-tion.Briefly,the fish was anesthetized with MS-222and placed on a petri dish cover to measure body length with a ruler underneath. The body was then gently dried with a piece of tissue for taking body weight on an analytical balance.After the measurements,the fish were either allowed to recover in water or killed by decapita-tion for histological examination.The decapitated fish was imme-diately fixed in Bouin’s solution for at least24hours.The fixed samples were dehydrated and embedded in paraffin and then seri-ally cut into7-?m sections on a Leica microtome.Slides were stained with hematoxylin and eosin and mounted with Canada balsam(Sigma-Aldrich)for microscopic examination.

RNA isolation and RT-PCR

Total RNA was extracted from individual pituitary glands using Tri-Reagent(Molecular Research Center)according to

the Figure3.HRMA(A and B)and HMA(C and D)for mutations in F1and F2fish.The F0founders with mutations detected by HRMA on caudal fin gDNA were crossed with WT partners to generate F1individuals.The gDNA of2-month-old F1progeny was examined by both HRMA and HMA for the presence of mutations.In the HRMA assay(A and B),the smooth red curves are profiles of control WT fish,whereas the heterozygous F1siblings(?/?) display characteristic wavy HRMA profiles shown in different colors.The genotypes were further confirmed by HMA assay on PCR amplicons(C and D), which shows homoduplexes(asterisk)in WT(?/?)and homozygous F2mutants(?/?)and both homoduplexes and heteroduplexes(arrow)in heterozygous F1(?/?).The F1males and females that carried the same mutation were identified and crossed to generate homozygous mutant F2.The region containing the targeted sites was cloned and sequenced after PCR amplification of F1gDNA.The representative mutant sequences are listed at the bottom for each gene,and the sequence in blue was chosen for propagation to establish the mutant lines.

80Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January2015,29(1):76–98

manufacturer’s protocol and our previous report(42,53).Re-verse transcription(RT)was performed at37°C for2hours in a total volume of a10-?L reaction solution containing0.5?g oligodeoxythymidine,1?Moloney murine leukemia virus re-verse transcription buffer,0.5mM each deoxynucleotide triphosphate,0.1mM dithiothreitol,and100U Moloney mu-rine leukemia virus reverse transcriptase(Invitrogen).Conven-tional RT-PCR was used to confirm the mutations at mRNA level(15?L containing5?L of1:15diluted RT reaction),and real-time quantitative PCR(qPCR)was performed to

analyze Figure4.Genotype analysis for fshb(A and B)and lhb(C and D)mutants at gDNA(A and C)and mRNA(B and D)levels.Male and female F1 fish with the same mutation were crossed to obtain homozygous F2individuals.The gDNA was isolated from2-month-old F2caudal fins and subjected to HRMA(A and C).The WT(?/?),heterozygous(?/?),and homozygous(?/?)F2fish are labeled in red,green,and blue, respectively.Because the HRMA could not clearly distinguish the homozygous mutant(lhb?/?,blue)from the wild type(lhb?/?,red)well,we spiked the sample with wild-type gDNA to create heteroduplexes(WT?lhb?/?,brown),which could be easily detected by shifted curve and melt peak(arrow).The mutation of fshb and lhb genes at transcription level was further confirmed by RT-PCR(B and D).The primer P3is specific for the deleted sequences,and ef1a is used as the internal control.

doi:10.1210/https://www.360docs.net/doc/3c2301675.html,81

the lhb expression level in individual pituitary glands(20?L containing9.5?L of1:10diluted RT reaction)on the real-time PCR detection system(Bio-Rad Laboratories).The specific primers used are listed in Table1.

Fertility assay

The fertility of different genotypes was assessed by natural mating with fertile partners.Individuals that failed to spawn or produce fertilized embryos after at least10trials were consid-ered infertile.

Data analysis

The expression level of lhb was normalized to that of the internal control ef1a for statistical analysis.All values were expressed as the mean?SEM,and the data were analyzed by a Student’s t test(lhb expression)or a one-way ANOVA followed by a Tukey’s multiple comparison test[body weight(BW),standard length(SL),and gonadosomatic index (GSI)]using Prism6on Macintosh OS X(GraphPad Software).

Results

High efficiency of TALEN-induced mutagenesis of zebrafish fshb and lhb genes

To maximize the chance of inducing loss of function of the targeted gene,the TALEN binding sites were chosen within the second exon immediately down-stream of the translation start site for both fshb and lhb (Figure1).The customized TALEN mRNAs were

effi-Figure5.Effects of fshb(A and B)and lhb(C and D)gene disruption on ovarian growth and spawning in female zebrafish at60dpf.A, Anatomical and histological examination of the ovary in fshb-deficient fish(fshb?/?)and controls(fshb?/?and fshb?/?).B,GSI in controls and fshb-deficient fish(n?3–4,P?.05).C,Anatomical and histological examination of the ovary in lhb-deficient fish(lhb?/?)and controls(lhb?/?and lhb?/?).D,Failed oocyte maturation and ovulation in lhb-deficient fish(lhb?/?)at9:00AM,1hour after lights on.LV,late vitellogenic;MV, midvitellogenic.

82Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January2015,29(1):76–98

cient in inducing somatic mutation at the targeted loci. When analyzed by HRMA at24hours after fertiliza-tion,the mutation rates were30%(3of10)and100% (10of10)for fshb and lhb,respectively(Table2).The PCR amplicons were cloned and sequenced to confirm the mutations,and the sequences of some representa-tive mutations are shown in Figure2.The melt curves of mutation-carrying embryos showed significant shift-ing as compared with those of the control.Despite the shifting,the curves were generally smooth,indicating mosaicism of the mutations(Figure2).The remaining F0founder embryos were raised to adulthood and genotyped by HRMA on gDNA isolated from the fin cuts.Most individuals harbored somatic mutations,with60%(6of10)for fshb and100%(10of10)for lhb.To evaluate the efficiency of germ line transmis-sion of the mutations,individual F0fish carrying mu-tations were crossed with wild-type partners to obtain F1offspring.The gDNA was isolated from individual F1embryos from one F0fish and analyzed by HRMA. About20%(4of20)F1embryos for fshb and35%(7 of20)for lhb were heterozygous mutants,demonstrat-ing successful germ line transmission(Table2). Establishment of fshb and lhb KO lines

TALEN proteins existed in the embryos for less than1 day after injection(data not shown).Because there are approximately25–50primordial germ cells in the

ze-Figure6.Catch-up ovarian growth in fshb-deficient mutant(fshb?/?)of different ages(68,70and90pdf).PG,primary growth;PV, previtellogenic;EV,early vitellogenic;MV,midvitellogenic;LV,late vitellogenic;and FG,full-grown.

doi:10.1210/https://www.360docs.net/doc/3c2301675.html,83

brafish at 24days post fertilization (dpf)(54),the germ-lines of F0founders are likely mosaic;however,the level

of mosaicism may not be as high as that in the somatic

cells.In most of the fshb and lhb F0founders screened,as

many as four mutant sequences could be identified in the

F1embryos from individual F0fish.With the high fecundity of the zebrafish,it is possible to obtain sibling male and female F1individuals that carry the same DNA sequence alteration,making it possible to obtain homozygous mutants in F2generation.HRMA profiles

of three different mutated sequences at the targeted loci of fshb and lhb from young adult F1fish (?/?;2mo)are shown in Figure 3,A and B.Different from the smooth HRMA curves from mosaic F0fish,the curves from the heterozygous F1individuals showed typical wavy patterns,indicating the existence of three DNA helixes (wild type,mutant,and hybrid).An HMA also confirmed the genotypes of the heterozygous F1individuals with the presence of both hetero-duplex and homoduplex molecules (Figure 3,C and D).For fshb ,a 10-bp deletion (?10)leading to a frame shifting of the coding se-quence was chosen to establish the

mutant line for phenotype analysis,and a 5-bp deletion for lhb (?5)was selected (Figure 3).

Among sibling F1fish,we successfully identified males

and females that carried the same mutant sequences for

both fshb ?10/?and lhb ?5/?.Homozygous fshb ?/?(?10)

and lhb ?/?

(?5)were obtained in F2,and their genotypes were confirmed by HRMA (Figure 4,A and C)and HMA (Figure 3,C and D).

To further confirm the successful deletion of the fshb and lhb genes,we also performed RT-PCR analysis for fshb and lhb mRNAs in the pituitary to ensure no

expres-

Figure 7.Embryonic offspring from fshb and lhb -deficient zebrafish (fshb ?/?and lhb ?/?).The fertility of homozygous fshb and lhb mutant fish was assessed by natural breeding between mutants or with wild-type fish.Both male and female fshb mutants were fertile with healthy and

viable progeny (A),whereas male lhb mutant was fertile but not females (B).Twenty-two lhb -deficient females were examined,but none succeeded in spawning (Figure

5).

Figure 8.Delayed puberty onset in female fshb ?/?mutants of different ages (45–80dpf).Juvenile females were sampled at different ages (45–80pdf)for histological analysis.The upper panel shows low-magnification view of the cross-sections,highlighting the location and relative size of the ovaries (boxed),whereas the lower panel is the close-up of the ovary showing follicle composition.A,The ovaries from control fish (fshb ?/?and fshb ?/?)with normal growth rate and advanced follicle stages.B,The ovaries of mutant fish (fshb ?/?)with smaller size and PG follicles only.The age,genotype,SL,BW,and stage of follicles in the ovary are shown in the table.

84Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January 2015,29(1):76–98

sion of functional transcripts.Specific primers (P3)over the deleted sequences of fshb ?/?(?10)and lhb ?/?(?5)were used for the amplification (P3?P4).The result clearly showed the lack of expression of functional tran-scripts in the mutant pituitary glands.As controls,prim-ers that flank the mutant sites (P1and P4)could amplify the transcripts as expected with the amplicons from the homozygous mutants slightly smaller than the homozy-gous and heterozygous individuals (?/?and ?/?)(Fig-ure 4,B and

D).

Figure 9.Delayed puberty onset in female fshb ?/?mutants of the same age (55dpf).Juvenile females of the same age were sampled for

morphological and histological analysis.A,The ovaries from control fish (fshb ?/?and fshb ?/?)with PV follicles (arrow).B,The ovaries of mutant fish (fshb ?/?)with PG follicles only.The age,genotype,SL,BW,and stage of follicles in the ovary are shown in the table (C).

doi:10.1210/https://www.360docs.net/doc/3c2301675.html, 85

Delayed ovarian growth and follicle development in FSH-deficient but not LH-deficient zebrafish

In our aquarium system,the zebrafish starts spawning around 2months after fertilization,although the fecun-dity is not high at this young stage.We first analyzed the

gross morphology and histology of the ovary in both the controls (fshb ?/?and fshb ?/?;lhb ?/?and lhb ?/?)and homozygous mutants (fshb ?/?and lhb ?/?)at 60dpf.With similar standard length and body weight,the FSH-deficient females (fshb ?/?)showed apparently smaller ab-domens compared with the control individuals (homozygous fshb ?/?and heterozygous fshb ?/?).It was indeed difficult to identify the gen-der of these fish until after dissection and with the help of microscope.The ovaries of the mutant fish were significantly smaller than those of the control individuals (Figure 5A),as demonstrated by the gonadoso-matic index (GSI ?gonadal weight/total body weight;P ?.05)(Figure 5B).Dissection and histological analysis showed that the ovaries from the control fish (?/?and ?/?)contained a full range of developing follicles from the PG (stage I)to the FG (stage III)stage,in agreement with the fact that these fish had started spawning.In contrast,the ovaries from the mutant FSH-defi-cient fish (?/?)contained mostly the PG follicles with a few follicles at the PV (previtellogenic;stage II),suggesting a significant block at the PG-PV transition and delayed devel-opment into the vitellogenic growth (Figure 5A).

In contrast,the lack of LH did not seem to have any effect on ovarian growth.The LH-deficient female fish (lhb ?/?)at 60dpf showed no dif-ference from the control of both ho-mozygous (lhb ?/?)and heterozygous (lhb ?/?)fish at either gross anatomi-cal or histological level.The ovaries in all three genotypes showed full development with all stages of fol-licles present from PG to FG stage (Figure 5C).

Failed spawning in LH-deficient but not FSH-deficient female zebrafish

Although the LH-deficient fe-males showed normal ovarian growth in contrast to that of

FSH-

Figure 10.Normal puberty onset in female lhb ?/?mutants.Both control (lhb ?/?and lhb ?/?)(A)and mutant fish (lhb ?/?)(B)had PV follicles with cortical alveoli (arrow)in their ovaries.The fish had similar age (50–55dpf)and body size.The age,genotype,SL,BW,and stage of follicles in the ovary are shown in the table (C).

86Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January 2015,29(1):76–98

deficient fish,these fish were infertile because they failed to spawn to produce fertilizable eggs.We examined all genotypes (lhb ?/?,lhb ?/?,and lhb ?/?)for spawning.All control individuals of homozygous (lhb ?/?)and heterozygous (lhb ?/?)genotypes spawned successfully (10fish each),producing fully vital offspring.In con-trast,none of the homozygous mutant individuals (lhb ?/?)succeeded in spawning (22in total).Further examination of the ovaries at 9:00AM when the light turned on showed that the control ovaries normally contained large number of mature and ovulated eggs with the chorion membrane separated from the egg and expanded;in contrast,only FG but immature follicles (no germinal vesicle breakdown)were present in the mutant ovaries,indicating a failure of final oocyte maturation (Fig-ure 5D).A few individual follicles were sometimes found to have undergone germinal vesicle breakdown in the ovary of the lhb KO mutant fish,but they were never ovulated (data not shown).

Interestingly,although the FSH-deficient females showed significantly delayed ovarian growth as de-scribed above at 60dpf,the development could quickly catch up in the month afterward.As shown in Figure 6,after a significant delay,the ovaries in

FSH-deficient

Figure 11.No effect of fshb and lhb gene disruption on spermatogenesis in the testis at mature stage (80dpf).Phenotypically male individuals were sampled at 80dpf and their gross morphology and histology were observed.All the individuals contained typical white thread-like testes (arrow),and histological examination showed normal cellular composition of testis in all genotypes for both fshb (A)and lhb (B).The fertility of these male fish had been tested by natural spawning (Figure 7).sc,spermatocytes;sg,spermatogonia;sz,spermatozoa.

doi:10.1210/https://www.360docs.net/doc/3c2301675.html, 87

fish(fshb?/?)gradually picked up the growth and be-came fully grown at90dpf(Figure6).In contrast to the LH-deficient females,the FSH-deficient females could successfully spawn eventually with vital offspring after the ovaries completed the growth(Figure7).Delayed puberty onset in FSH-deficient but not

LH-deficient females

Puberty onset is a very important event in reproductive development.The mechanisms underlying puberty onset in vertebrates remain elusive and poorly elucidated,and

they Figure12.Retarded spermatogenesis in FSH-deficient males(fshb?/?)at early developmental stage(64dpf).With the help of HRMA,male individuals of different genotypes were sampled at64dpf for histological examination.A,The testes of control fish(fshb?/?and fshb?/?)with normal size and spermatogenesis.B,The testes of mutant fish(fshb?/?)with smaller size and delayed spermatogenesis.The upper panel shows low-magnification view of the cross-sections highlighting the location and relative size of the testes(boxed),whereas the lower panel is the close-up of the testis showing stage of spermatogenesis.C,The age,genotype,SL,and BW of the fish shown.

88Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January2015,29(1):76–98

are entirely unknown in teleosts,especially with regard to the roles of gonadotropins in the process.After analyzing the impacts of FSH and LH deficiency on ovarian growth at the time of maturity as described above,we shifted our attention to the stage when puberty starts,which is marked by the appearance of the first cohort of PV follicles in the ovary.As we reported recently,the puberty onset in female zebrafish depends largely on body growth rather than age,and we have defined100mg body weight and1.80cm standard body length to be critical thresholds for the initiation of puberty(55).These criteria were also used in the present experiment to help with the evaluation of puberty onset and the impacts of FSH and LH deficiency.

We examined six homozygous mutant individuals (fshb?/?)of different ages(45–80dpf)with SL and BW, ranging from1.70to2.65cm and99to320mg,respec-tively,covering the point when puberty onset is expected to occur(1.80cm SL and100mg BW).As shown in Figure8,none of these mutant fish had PV follicles in the ovary,suggesting a significant delay of puberty onset in FSH-deficient females despite the fact that most individ-uals had crossed the thresholds in terms of either BW or SL or both.Female mutants could not break through the PG-PV transition even at70–80dpf with an SL of2.35 and2.65cm,well above the1.80-cm threshold defined previously(55).Furthermore,a histological examina-tion of whole-body cross-sections showed an overall smaller ovarian size in the mutants as compared with those in the controls.In contrast,all control fish of both homozygous and heterozygous genotypes(?/?and?/?) showed a normal initiation of puberty with PV and ad-vanced follicles[early vitellogenic(EV)and late vitello-genic]appearing in the ovary once the SL and BW ap-proached or crossed the defined threshold levels(1.80cm and100mg)(Figure8).

To rule out the influence of age on the result shown above in Figure8,we carried out one additional experiment by using fish of the same age at55dpf,when the puberty onset is expected to have happened according to our recent report (53).The result was consistent with that described in Figure 8.The control fish(?/?and?/?)with SL and BW above the threshold levels all had PV follicles well formed in the ovary(fshb251and fshb257).Even those slightly below the thresholds(fshb244and fshb245)showed signs of early PV follicles.However,none of the fshb KO mutant fish (?/?)showed any sign of PV follicle development,even in those with body sizes much bigger than the controls (Figure9).

In contrast to FSH-deficient fish,no significant pu-berty delay was observed in LH-deficient females.We performed the analysis at50–55dpf,the time when pu-berty onset is normally expected to occur(53,55),on individuals with SL and BW around or above the defined threshold levels(1.80–1.95cm and97–143mg).All in-dividuals had PV follicles well formed in the ovary with no difference among the three genotypes(lhb?/?,lhb?/?and lhb?/?)(Figure10).

Normal development of testis in FSH and

LH-deficient males at maturation stage

We also analyzed the phenotypes of male fshb and lhb KO zebrafish at80dpf.Surprisingly,neither fshb nor lhb KO mutants(?/?)showed significant signs of abnormal-ity in their testis development and spermatogenesis at gross anatomical and histological levels as compared with the con-trols.All stages of sperm cells including spermatogonia(sg), spermatocytes(sc),and spermatozoa(sz)were present in all individuals of the three genotypes(Figure11).Furthermore, all mutant fshb?/?and lhb?/?males were fertile as demon-strated by their successful spawning with females to produce normal offspring(Figure7).The lhb?/?males were tested with WT females as the lhb?/?females were unable to spawn and therefore infertile as described above.

Despite the normal fertility of fshb?/?and lhb?/?males at the mature stage,there was evidence for a role of gonadotropins in promoting early testis development,es-pecially for FSH.As shown in Figure12,when examined at64dpf when all control males(fshb?/?and fshb?/?) Figure13.Expression of lhb in the pituitary glands of control

(fshb?/?)and FSH-deficient(fshb?/?)female(A)and male(B)fish(130 dpf).Total RNA from each pituitary gland was reverse transcribed for real-time qPCR quantification of lhb expression,which was normalized to ef1a(mean?SEM,n?6).*,P?.05vs control.

doi:10.1210/https://www.360docs.net/doc/3c2301675.html,89

had their testes well developed with all stages of sper-matogenesis present,there was an obvious delay of sper-matogenesis in the fshb KO mutant fish (?/?),although all mutant fish examined had larger body sizes than those of the controls.The testes of the mu-tant fish contained germ cells mostly at the early stages of spermatogene-sis including spermatogonia and spermatocytes,and the germ cells of advanced stages were seldom pres-ent in the mutant testes.Further-more,the overall sizes of the testes were also much smaller than those in the controls (Figure 12).Increased expression of lhb in the pituitary glands of FSH-deficient fish

The results described above (Fig-ures 6and 12)showed that although there was a significant retardation of gonadal growth in FSH-deficient fe-males and males,the growth of ovary and testis could both catch up after a period of delay,leading to normal fertility in both sexes.One mechanism for the catch-up growth was likely due to the cross-activa-tion of FSH receptor Fshr by LH as we reported previously (41).To pro-vide supportive evidence for this hy-pothesis,we examined the expres-sion of lhb in the pituitary glands of FSH-deficient females and males (130dpf).Interestingly,the expres-sion level of lhb increased signifi-cantly in the pituitaries of female fshb ?/?fish.The level increased also in males,but it was not statistically significant due to high individual variation (Figure 13).We were un-able to measure plasma FSH and LH levels in the zebrafish because of the lack of specific RIAs in this species.

Evidence for a role of FSH in maintaining female status in mature adults

During our large-scale screening by histology,we discovered two fshb ?/?mutant fish with ovotestis

(fshb65and fshb140).This was never found in any other genotypes including lhb

?/?

mutants.Fshb65(68dpf)had a testis on one side but ovotestis on the other side with ovarian tissue being dominant,whereas in fshb140(72dpf),the

testis

Figure 14.Sexual reversal in FSH-deficient adult zebrafish.Two fish at 68and 72dpf were

identified with ovotestis.Fshb65(?/?)was fixed and sectioned as a whole with gonadal location

clearly shown on both sides,whereas for fshb140(?/?),the gonads were isolated for fixation and

sectioning.sc,spermatocytes;sg,spermatogonia;sz,spermatozoa.90Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January 2015,29(1):76–98

issue was dominant.The ovarian and testis tissues were well separated without much mingling in both fish,and the ovarian tissues contained well-developed vitellogenic follicles (PV and EV)with some undergoing degeneration

or apoptosis (Figure 14).The pres-ence of vitellogenic follicles indi-cated that the fish were likely geno-typically female,and they might possibly be undergoing sex reversal.No evidence for the

involvement of FSH and LH

alone in gonadal differentiation The discovery of hermaphroditic fshb ?/?fish in adult stage prompted us to speculate a possible role for gonadotropins in influencing go-nadal differentiation.To address this issue,we did an experiment to analyze the development of gonads at 35–40dpf (35dpf for fshb and 40dpf for lhb ).This time window was chosen because our previous study has shown that the zebrafish ovary forms from the undifferentiated so-called ovary-like state around 30dpf,whereas the formation of testis lagged behind by approximately 2weeks,ie,approximately 45dpf (55).Our result showed that all four genotypes analyzed (fshb ?/?and fshb ?/?;lhb ?/?and lhb ?/?)had fe-males with well-formed ovaries con-taining early perinucleolar oocytes (fshb302and fshb309,lhb76and lhb80)and undifferentiated gonads,which might likely develop into tes-tis as shown by early signs of sper-matogenesis (presence of spermato-gonia and spermatocytes)(fshb300and fshb298,lhb94and lhb90)(Fig-ure 15).We did not observe any dif-ference between heterozygous fish (fshb ?/?and lhb ?/?)and homozy-gous mutants (fshb ?/?and lhb ?/?).

Production of all-male offspring with double mutations of fshb and lhb

The significant phenotypes of de-layed development of ovary and tes-tis but normal fertility in the end in fshb ?/?fish led us to hypothesize

that LH could play a compensatory role due to its cross-activation of Fshr.This idea was supported by the evi-dence that the expression of lhb increased in fshb ?/?

fish

Figure 15.No effect of fshb and lhb gene disruption on gonadal differentiation.To investigate whether gonadotropins play any roles in gonadal differentiation,samples were taken at 35dpf for fshb and 40dpf for lhb .At 35dpf,both control (fshb ?/?)and mutant (fshb ?/?)had already completed gonad differentiation,with no significant difference between the two https://www.360docs.net/doc/3c2301675.html,pared with the ovary,the formation of testis was slower.The same was observed for control and mutant lhb at 40dpf.

doi:10.1210/https://www.360docs.net/doc/3c2301675.html, 91

(Figure 13).To provide further evidence for this hypoth-esis,we created a mutant zebrafish with double mutations of fshb and lhb.Interestingly,lack of FSH and LH led to all-male offspring.At 55dpf,the control fish expressing either fshb and lhb alone or both (fshb ?/?/lhb ?/?,fshb ?/

?/lhb ?/?

,and fshb ?/?/lhb ?/?)all had normal ovarian de-velopment;in contrast,the gonads of double-mutant fish (fshb ?/?/lhb ?/?)all stayed at very early stage without obvious signs of sexual differentiation (Figure 16).Fur-ther analysis of elder fish (100–120dpf)showed that all double-mutant fish developed into males (Figure 17A)(n ?31),whereas the control fish (fshb ?/?/lhb ?/?,n ?14;fshb ?/?/lhb ?/?,n ?32)exhibited normal gonadal differentiation and development (Figure 17B)with an ex-pected sex ratio (?50%females)(Figure 17C).The all-male phenotype did not seem to be due to sex reversal because no oocytes were observed in any individuals at any stage.The level of spermatogenesis in double-mutant

fish varied significantly among indi-viduals.Some individuals showed no development beyond spermato-gonial stage at 110dpf (Fish 1),whereas others exhibited develop-ment of spermatocytes and even ma-ture spermatozoa (Fish 2–5,100–120dpf).In general,most mutant fish had small testis size compared with those in control fish of similar or even younger age (Figure 17,A and B).Despite the significant de-lay in spermatogenesis,the double-mutant fish were fertile and they could breed with WT females to produce normal offspring (Figure 17D).

Discussion

Using TALEN technology,the pres-ent study analyzed the functions of FSH and LH hormones in zebrafish reproduction,which not only con-firmed some aspects of FSH and LH functions proposed before but also provided evidence for novel func-tions of these hormones that would be otherwise difficult to demon-strate with other approaches.

Roles of FSH and LH in folliculogenesis

In the zebrafish model,our previ-ous study on FSH and LH receptors (Fshr and Lhcgr)has provided important clues to the functions of FSH and LH in females,which to some extent agrees with the generally accepted concept that FSH plays a major role in stimulat-ing follicle growth via its cognate receptor Fshr,whereas LH is involved in final maturation and ovulation.How-ever,there has been no direct evidence to verify this con-cept.By deleting the fshb and lhb genes from the genome,we provide the most comprehensive and conclusive ge-netic evidence so far in any teleost species for roles of these two important reproductive hormones.

Loss of the fshb gene and therefore the FSH hormone caused a significant retardation of follicle growth in fe-male zebrafish,especially at the PG-PV transition.This is similar to the phenotype observed in the FSH-deficient mice whose follicle development is blocked at the antral stage,resulting in female infertility (4).Interestingly,

de-

Figure 16.Gonadal development in fshb and lhb double mutants at 55dpf.A,Control fish expressing both fshb and lhb (fshb ?/?/lhb ?/?)or fshb and lhb alone (fshb ?/?/lhb ?/?,fshb ?/?/lhb ?/?)had normal ovarian formation.Arrows indicate PV follicles.B,Double mutations of fshb and lhb (fshb ?/?/lhb ?/?)led to the retarded development of the gonads (testis?)(circled and labeled by arrow).

92Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January 2015,29(1):76–98

spite a significant blockade at the PG-PV transition in the absence of FSH,PV follicles could still emerge after a delay in the zebrafish ovary,which differs from the situ-ation in the mouse (4).Once entering the PV stage,the follicles in fshb KO fish could quickly pick up the growth to complete the process of vitellogenesis in about one month,although the growth rate seemed slower than nor-mal,which takes about 2weeks according to our previous studies (42,56).This phenomenon raises an interesting question.After a delayed activation,what eventually trig-gers some follicles to break the blockade at PG-PV tran-sition to enter the vitellogenic growth?The answer re-mains unknown.We speculate that LH likely plays a compensatory role.

Our previous study has shown that LH can cross-acti-vate Fshr in the zebrafish at high concentrations (41),and this promiscuous activation of Fshr would allow a com-pensatory role for LH to drive folliculogenesis in the ab-sence of FSH.When the PG follicles grow to their full size prior to entering the PV stage,the expression of Fshr increases (42,43),therefore increasing the responsiveness of the follicles to FSH and probably,to a lesser extent,LH as well.Without FSH,LH may play a role in initiating the PG-PV transition albeit at slower rate due to its lower potency in stimulating Fshr (Figure 18).This idea is fur-ther supported by our evidence that lhb expression in the pituitaries of FSH-deficient fish increased in both females and males.It is conceivable that such an increase in LH biosynthesis may contribute to the compensatory role of LH in the absence of FSH.The mechanism for the in-creased lhb expression is unknown,and it will be an in-teresting issue to address in future studies.

The promiscuous activation of Fshr by LH has been reported in several species including the zebrafish (41).However,the functional significance of this partial acti-vation of Fshr by LH has remained entirely unknown and mysterious.The genetic approach adopted in this study by deleting the fshb and lhb genes seems to have provided a conceivable answer to the question.Despite this,we still need to be cautious in that the compensatory role of LH was revealed in the absence of FSH,which is a nonphysi-ological condition.Further studies on the fshr mutant will provide insight into this

issue.

Figure 17.All-male development in fshb and lhb double mutants at 100–120dpf.A,Double mutations of fshb and lhb (fshb ?/?/lhb ?/?)

produced all-male offspring with delayed development of the testis (circled).B,Control fish (fshb ?/?/lhb ?/?,fshb ?/?/lhb ?/?,fshb ?/?/lhb ?/?)had normal testis growth (circled)and spermatogenesis.C,Sex ratio in fshb and lhb double mutants.D,Normal fertility of fshb and lhb double mutants.sc,spermatocytes;sg,spermatogonia;sz,spermatozoa.

doi:10.1210/https://www.360docs.net/doc/3c2301675.html, 93

In contrast to FSH,the lack of LH had no observable effect on follicle growth in the zebrafish but caused infer-tility due to failed oocyte maturation and ovulation in vivo.This is in contrast to the infertility in LH-deficient female mice whose ovaries are small with abnormal antral follicles (5).This result also suggests that FSH plays no compensatory role for LH in controlling final oocyte mat-uration and ovulation in the zebrafish.

Roles of FSH and LH in female puberty onset

In fish,the appearance of the first wave of PV follicles in the ovary is considered a marker for puberty onset in females (55,57,58).Little is known about the mecha-nisms that trigger and control puberty onset in fish spe-cies.We previously proposed that FSH could be a poten-tial factor that triggers puberty onset in females because of the significant increase of fshr expression in PV follicles (42).However,our subsequent study on ontogeny of fshb and lhb expression during development led us to a differ-ent view that instead of FSH,it was likely LH that played a role in the event because the expression of lhb in the pituitary was very low before puberty but increased dra-matically when the first wave of PV follicles appeared in the ovary (53).This view,however,is not supported by the evidence from the present study.In contrast to the loss of fshb ,which caused a significant delay in PV follicle development,the disruption of the lhb gene had no effect at all on the timing of the PG-PV transition.Based on this,

we can conclude that the previously observed surge in lhb expression at puberty onset is the consequence rather than the cause of puberty onset.

Roles of FSH and LH in spermatogenesis

One of the most striking discoveries in the present study was the role of FSH and LH in testis development and spermatogenesis in males.In the absence of FSH and LH alone or both,the males were all fertile with a normal ability to spawn and produce vital offspring,although fshb ?/?mutant and fshb ?/?/lhb ?/?double-mutant fish had slower testis growth.This result suggests that differ-ent from our traditional view on the importance of neu-roendocrine regulation of gonadal development and func-tion (59),the classical reproductive axis involving FSH and LH may play a less-than-expected role in the repro-duction of male zebrafish.It is likely that after the initial promotion by FSH to trigger male puberty in juveniles,the process of spermatogenesis becomes independent of pituitary gonadotrophic hormones.This agrees with a view in mammals that FSH plays a role in initiating sper-matogenesis but not in maintaining the process in adults (4,60,61),although this concept still remains controver-sial (62).In FSH-deficient mice,the males are fertile but oligospermic with smaller testes (4),which agrees well with our finding in the zebrafish.As for the role of LH,our discovery is in sharp contrast to that in mammals.The LH-deficient zebrafish males seemed normal with full

ca-

Figure 18.Hypothetical model for roles of FSH and LH in controlling follicle development and maturation in the zebrafish ovary.FSH rather than LH plays a key role in setting the timing of puberty onset in females,and FSH is a dominant hormone in controlling follicle growth afterward.In the absence of FSH,LH will kick in to play a role in initiating follicle activation (PG-PV transition)and promoting its growth via its cross-reaction with the FSH receptor (Fshr).At the end of folliculogenesis,it is LH but not FSH that plays a critical role in triggering final oocyte maturation and ovulation in females.In addition to promoting follicle growth,FSH may also play a role in maintaining female status in adult,probably through stimulating and maintaining aromatase expression in the ovary.

94Zhang et al Genetic Analysis of Zebrafish FSH and LH Functions Mol Endocrinol,January 2015,29(1):76–98

pacity to reproduce.In LH-deficient mice,however,both males and females are infertile(5).The major regulators of spermatogenesis in adult male zebrafish may come from other endocrine axes,in particular the soma-totrophic axis.This view is supported by in vitro evi-dence that the spermatogenesis in cultured zebrafish testis could be promoted by IGF-1alone,which stimu-lated the development of spermatogonia to spermato-cytes and spermatids(63).

Roles of FSH and LH in gonadal differentiation One interesting discovery in the present study was the hermaphroditic fish in fshb KO mutants at the adult stage.Although we should be cautious in interpreting the result due to the small sample size,it raises a possibility for a role of FSH in maintaining female status after sexual differentiation.It is likely that despite the compensatory role of LH in supporting folliculogenesis,the lack of FSH may lead to a lower expression level of aromatase in the ovary,making the fish susceptible to both internal and external influences that favor a conversion of ovary into testis through sex reversal.This idea is supported by re-cent studies in the zebrafish that demonstrated sex rever-sal in mature adult females after treatment with aroma-tase inhibitor(64,65).

To test this hypothesis,we went on to generate a mu-tant zebrafish that carries double mutations of fshb and lhb.Unexpectedly but interestingly,all double mutant fish turned out to be males with normal but retarded testis growth and spermatogenesis.The production of all-male offspring raises an interesting question on the role of go-nadotropins in sexual differentiation.Our previous study has demonstrated that during zebrafish life cycle,the ex-pression of lhb appeared first at the time of gonadal dif-ferentiation,and its signal could be detected only in the pituitaries of individuals whose gonads contained well-developed oocytes;in contrast,there was no detectable lhb expression in those with either undifferentiated go-nads or testis.This has led us to hypothesize that gonad-otropins may likely play a role in gonadal differentiation (53).The all-male phenotype of fshb and lhb double mu-tation provides a strong support to this hypothesis.The effect of LH on ovarian differentiation may be subtle in the presence of FSH;however,it becomes significant in the absence of FSH.

Table3.Phenotype Comparison of FSHB/Fshb/fshb and LHB/Lhb/lhb Mutants in Humans,Mice,and Zebrafish

Gene Gender Species Phenotype Reference fshb Female Human 1.Hypogonadism(66–68)

2.Delayed puberty

3.Amenorrhea

4.Infertile

Mouse 1.Arrested folliculogenesis at antral formation(4)

2.Infertile

Zebrafish 1.Delayed puberty Present study

2.Slower folliculogenesis

3.Fertile

Male Human 1.Hypogonadism(69)

2.Azoospermia

Mouse 1.Smaller testis(4)

2.Fertile

Zebrafish 1.Slower progression of initial spermatogenesis Present study

2.Fertile

lhb Female Mouse 1.Small ovary(5)

2.Abnormal folliculogenesis

3.Degenerating antral follicles

4.Absence of corpora lutea

5.Infertile

Zebrafish 1.Normal folliculogenesis Present study

2.Failed oocyte maturation and ovulation

3.Infertile

Male Human 1.Delayed puberty(70)

2.Infertile

Mouse 1.Smaller testis(5)

2.Reduced testosterone level

3.Blocked spermatogenesis at round spermatid stage

4.Infertile

Zebrafish 1.Normal spermatogenesis Present study

2.Fertile

doi:10.1210/https://www.360docs.net/doc/3c2301675.html,95