pcr检测水痘病毒

Journal of Virological Methods 113(2003)

113–116

Short communication

A real-time PCR assay for the detection of varicella-zoster virus DNA

and differentiation of vaccine,wild-type and control strains

Graham A.Tipples ?,David Safronetz,Michael Gray

National Microbiology Laboratory,Health Canada,1015Arlington Street,Winnipeg,Man.,Canada R3E 3R2

Received 20May 2003;received in revised form 23July 2003;accepted 24July 2003

Abstract

Varicella-zoster vaccine is a live attenuated virus.It is,therefore,necessary to have a test to differentiate vaccine from wild-type varicella-zoster virus (VZV)strains for the investigation of varicella or zoster-like rash illness in individuals vaccinated previously.In addition,it is necessary to have a rapid VZV assay for use in the context of smallpox bioterrorism laboratory https://www.360docs.net/doc/3d10115423.html,ing speci?c primers and hybridization probes,a rapid method to differentiate vaccine strain VZV from wild-type VZV was developed based on the presence or absence of a Pst I restriction site within open reading frame (ORF)https://www.360docs.net/doc/3d10115423.html,ing this ORF 38assay in conjunction with a similar previously described ORF 62assay allows for further differentiation of vaccine strain,wild-type and a laboratory control strain (Ellen)VZV .This is accomplished because Ellen VZV is similar to wild-type VZV with respect to the ORF 38assay but is similar to vaccine strain VZV with respect to the ORF 62assay.The hybridization probes for each ORF are labeled with different ?uorescent tags thus allowing both assays to be run simultaneously in a single tube.Both assays demonstrate a high degree of speci?city for VZV and can reliably detect between 10and 100copies of VZV DNA.Thus,the real-time polymerase chain reaction (PCR)assay for VZV described below provides a rapid assay allowing the simultaneous differentiation of vaccine,wild-type and laboratory control strains of VZV .?2003Elsevier B.V .All rights reserved.

Keywords:Chickenpox;Shingles;LightCycler

Primary infection with varicella-zoster virus (VZV)causes chickenpox (varicella),a common childhood illness characterized by a generalized vesicular rash.As a typical herpesvirus,VZV establishes latency in the host sensory nerve ganglia,and can reactivate at a later time to cause shingles (zoster)in individuals with waning immunity.Al-though chickenpox and shingles are rarely fatal,serious and painful complications are known to occur.In adults and immunocompromised individuals varicella is more severe and may result in varicella pneumonia or disseminated dis-ease.During pregnancy,varicella can result in congenital malformations in the fetus or disseminated varicella in the neonate depending on the time of infection.

There is a live attenuated VZV vaccine which was de-veloped in Japan in the mid-1970s (Takahashi and Plotkin 2000).VZV vaccine was licensed for use in the US in 1995(Centers for Disease Control,1996),and in Canada in 1998

?

Corresponding author.Tel.:+1-204-789-6080;fax:+1-204-789-5009.

E-mail address:graham tipples@hc-sc.gc.ca (G.A.Tipples).

(Health Canada,1999).As the VZV vaccine is a live virus,it can establish latency in the https://www.360docs.net/doc/3d10115423.html,d chickenpox has been shown to be a rare vaccine associated adverse event,and the vaccine strain has also been shown to reactivate to cause mild shingles (Liang et al.,1998;White,1996).In addition,break-though wild-type VZV infections have been shown to occur occasionally in individuals vaccinated previously (White,1997;Gail et al.,2002).It is,therefore,necessary to monitor all VZV infections in previously immunized in-dividuals to determine whether the infection is the result of wild-type or vaccine strain virus.

In general,chickenpox is easily diagnosed clinically.However,laboratory con?rmation of VZV infections are useful for differentiation from other vesicular rash illnesses such as herpes simplex,for the differentiation of wild-type and vaccine strains in the laboratory investigation of chick-enpox or shingles in previously immunized individuals,and now in an era with bioterrorism threats,smallpox.Although the latter instance is hopefully a rare if not non-existent sit-uation,it is still necessary for rapid diagnostic procedures to be in place to respond to such a situation.Vesicular ?uid

0166-0934/$–see front matter ?2003Elsevier B.V .All rights reserved.doi:10.1016/S0166-0934(03)00229-5

114G.A.Tipples et al./Journal of Virological Methods113(2003)113–116

from VZV lesions contain infectious virus and VZV can be con?rmed by virus isolation,direct?uorescence assay us-ing monoclonal antibodies,or by polymerase chain reaction (PCR).As in all PCR diagnostic tests,it is important to be able to clearly differentiate the PCR products of the posi-tive control from the clinical specimen.In addition,we are interested in differentiating vaccine from wild-type VZV strains.The real-time PCR assay we describe below is a rapid test which allows for the differentiation of wild-type, vaccine and control VZV strains.

Numerous studies have been published describing dif-ferences between different VZV strains,in particular dif-ferences between the vaccine and wild-type strains(Argaw et al.,2000;Hawrami and Breuer,1997;Martin et al.,1982; Shiraki et al.,1991).The Pst I site in open reading frame (ORF)38of VZV has been shown to be absent in the Oka vaccine strain but present in wild-type strains,with the ex-ception of some minor Japanese wild-type strains which are Pst I negative(LaRussa et al.,1992).A Sma I site in ORF 62has been shown to be absent in all wild-type strains,and present in the Oka vaccine strain,and thus be a useful marker for differentiating wild-type from vaccine strain infections (Loparev et al.,2000a).Loparev et al.(2000b)have de-scribed a real-time PCR assay based on using this restriction site to differentiate rapidly wild-type and vaccine strains. We have extended this work to include a similar real-time PCR assay for the Pst I site in ORF38.We have determined that the Ellen VZV strain is vaccine strain-like with respect to ORF62and wild-type-like with respect to ORF38.By using the Ellen strain as our PCR positive control,and run-ning the Loparev ORF62real-time PCR in addition to the ORF38real-time PCR,we are able to differentiate rapidly wild-type,vaccine strain and positive control VZV strains. Forward and reverse primers were designed to amplify a 347base pair(bp)region of VZV ORF38.Hybridization probes were then designed to bind over the Pst I site within the347bp amplicon allowing for differentiation of vaccine strain VZV from wild-type.Previously described primers and probes for ORF62were also used to amplify and differ-entiate VZV vaccine strain from wild-type(Loparev et al., 2000b).See Table1for primer and probe sequences.

Table1

Oligonucleotide sequences for PCR primers and probes

Primer/probe Sequence(5 to3 )

ORF38CGGGTGAACCGTATTCTGAG

ORF38r TTGAACAATCACGAACCGTT

ORF38LC LC-Red640-ACGATATATACCGCAGTTGTTGCG ORF38FL GACTTGAAGATGAACTTAATGAAGCCCGTG-FL ORF62AACTCGCTGGCCCAAAGGTG

ORF62r GTGTCCGCTTTGAACGCCCG

ORF62LC LC-Red705-AGGTGGCCCAGGGATGGA

ORF62FL GTTGCTGGTGTTGGACGCGGTGGCCCT-FL

BG1CAACTTCATCCACGTTCACC

BG2GAAGAGCCAAGGACAGGTAC

FL:?uorescein label.

Real-time PCR was carried out on the LightCycler(Roche Applied Sciences,Laval,Que.).Each reaction contained2?l master mix(FastStart DNA Master Hybridization Probes, Roche Applied Sciences,Laval,Que.),3mM MgCl2,1?M of the forward and reverse primer,0.2?M of the?uorescein hybridization probe(FL probe,TIB MOLBIOL,Adelphia, NJ),0.4?M of the LC-Red640or705hybridization probe (LC probe,TIB MOLBIOL,Adelphia,NJ),2?l template VZV DNA.Water was added to bring the total volume to 20?l.Following an initial10min incubation at95?C,sam-ples were ampli?ed with45cycles of95?C for3s,62?C for7s,72?C for20s with?uorescence resonance energy transfer(FRET)measured after each annealing step.A?nal extension step at72?C for40s was done. Differentiation of the VZV isolates was achieved through melting curve analysis(Fig.1).Samples were denatured at 95?C for2min and equilibrated to45?C for40s.From 45?C,the temperature was slowly raised(0.3?C/s)to80?C, while the LightCycler continuously monitored the FRET for each sample.With the ORF38primers and probes wild-type and Ellen VZV had a melting peak at60.5?C while vaccine strain VZV melted at67.5?C.For the ORF 62primers and probes wild-type VZV had a melting peak of69.5?C,while Ellen and vaccine strain VZV melted at61.7?C.

The speci?city of the primers was assessed by running samples positive for genomic material from other her-pesviruses and potential rash causing agents.These samples included all of the human herpesviruses(herpes simplex viruses1and2,Epstein–Barr virus,cytomegalovirus,hu-man herpesviruses6A,6B,7and8),three simian alpha-herpesviruses(Cercopithecine herpesviruses type1(CeHV-1, Monkey B Virus)type2(CeHV-2,Simian Agent-8,SA-8) and type16(CeHV-16,herpesvirus papio2,HVP-2)),camel pox,an echovirus(E9)isolate,West Nile virus,dengue virus(serotype2),measles virus,rubella virus,enterovirus EV71,coxsackie viruses A-16and B-4,parvovirus B-19, and the bacterium Leptospira.Both sets of primers proved to be highly speci?c with VZV DNA being the only agent ampli?able with either set.

Ellen(ATCC#VR-1367),Oka(Varivax,Merck Frost, Kirkland,Que.)and a wild-type VZV isolates were cultured in MeWo cells(a gift from Dr.Charles Grose,University of Iowa)in DMEM(Gibco,Burlington,Ont.)supplemented with5%FBS,1%non-essential amino acids,and1%sodium pyruvate and incubated at37?C for approximately3–5days. The VZV nucleocapsids were isolated from infected MeWo cells as previously described(Safronetz et al.,2003). DNA was extracted from the nucleocapsid preparation using standard phenol–chloroform methods.To ensure the purity of the viral DNA,PCR was performed with primers speci?c for human beta-globin cellular house keeping genes(BG 1or2,see Table1for sequences)as previously described (Safronetz et al.,2003).The absorbance of the pure viral DNA was measured at260nm and the viral genome copy number determined.

G.A.Tipples et al./Journal of Virological Methods 113(2003)113–116115

(A)

5060

7080

Tm (?C)

F l u o r e s c e n c e [–d (F 2/F 1)/d T ]

0.05080

7060

Tm (?C)

F l u o r e s c e n c e [–d (F 3/F 1)/d T ]

0.016

0.0

0.008

(B)

Fig.1.ORF 38(A)and ORF 62(B)genotyping of VZV by melting curve analysis on the LightCycler.()Vaccine strain (Oka)VZV;()

wild-type VZV;()Ellen strain VZV;(—)no template control.Melting temperatures for each VZV strain are indicated above with arrows.

The sensitivity of the ORF 38and 62primers and probes was assessed by running 10-fold serial dilutions of known genomic equivalents of puri?ed vaccine and wild-type VZV DNA.Both sets of primers and probes detected reproducibly between 10and 100VZV genomic copies.

Although the samples used in this study were VZV iso-lates,the assay is sensitive (10–100genomic copies)and thus should prove useful for direct ampli?cation from clini-cal specimens (vesicular ?uid/swabs).In addition,many of the clinical virology labs in Canada,from where our refer-ence lab receives samples for testing,do virus isolation for VZV .Thus,this assay was developed and assessed in our laboratory using clinical VZV isolates.

A total of 20samples (18clinical isolate,Ellen strain,and vaccine strain)were blindly tested on the LightCycler using the ORF 38and 62assays described above and com-pared with restriction fragment length polymorphism results as originally described (LaRussa et al.,1992;Loparev et al.,2000a ).The 18clinical isolates included 14wild-type sam-ples,including VZV-BC (Tipples et al.,2002),and four samples spiked with Oka DNA.All 18samples were geno-typed correctly as wild-type or vaccine strains by the ORF 38and 62assays.Also,the Ellen control DNA was easily differentiated from the samples.

The LC probes used in the ORF 38and 62assays are la-beled with different ?uorescent tags (ORF 38uses LC-Red 640while ORF 62uses LC-Red 705).It was found that after calibrating the LightCycler instrument using a color com-pensation kit (Roche Applied Sciences,Laval,Que.)the two assays can be combined and run in a single capillary tube.Past rapid genotyping assays have focused on only one polymorphism in the VZV genome to differentiate wild-type and vaccine strains of VZV (Loparev et al.,2000b ).Com-bining the previously described ORF 62assay (Loparev et al.,2000b )with the ORF 38assay described in this study,allows for the additional differentiation of the Ellen (laboratory control)strain of VZV .Running these two as-says simultaneously in one capillary allows the inclusion and differentiation of the positive control from the clinical strains,and thus reduces the risk of false-positive results.In conclusion,this real-time PCR assay for VZV is a rapid and reliable method which allows for the simultaneous differentiation of wild-type,vaccine and laboratory control VZV strains.This method is useful for both the investigation

116G.A.Tipples et al./Journal of Virological Methods113(2003)113–116

of VZV-like illness in previously vaccinated individuals,and also for laboratory con?rmation of VZV in the context of smallpox bioterrorism laboratory investigation. Acknowledgements

We wish to thank Dr.Richard Garceau,Dr.Michael Car-penter,Dr.Michael Drebot,Dr.Runtao He,Dr.Alberto Sev-erini,Brian Klisko,Michael Garbutt and Allan Grolla for providing virus samples for use in this study. References

Argaw,T.,Cohen,J.I.,Klutch,M.,Lekstrom,K.,Yoshikawa,T.,Asano, Y.,Krause,P.R.,2000.Nucleotide sequences that distinguish Oka vaccine from parental Oka and other varicella-zoster virus isolates.J.

Infect.Dis.181,1153–1157.

Centers for Disease Control,1996.Prevention of varicella:recommenda-tions of the advisory committee on immunization practices(ACIP).

MMWR45,1–36.

Gail,K.,Lee,B.,Shrine,T.,Carraher,C.,Baughman,A.L.,Eaton,M., Montero,L.,Steward,J.,2002.Outbreak of varicella at a day-care center despite vaccination.N.Engl.J.Med.347,1909–1915. Hawrami,K.,Breuer,J.,1997.Analysis of United Kingdom wild-type strains of varicella-zoster virus:differentiation from Oka vaccine strain.

J.Med.Virol.53,60–62.

Health Canada,1999.National committee on immunization statement on recommended use of varicella virus https://www.360docs.net/doc/3d10115423.html,mun.Dis.

Rep.25,1–16.

LaRussa,P.,Lungu,O.,Hardy,I.,Gershon,A.,Steinberg,S.P.,Silverstein, S.,1992.Restriction fragment length polymorphism of polymerase

chain reaction products from vaccine and wild-type varicella-zoster virus isolates.J.Virol.66,1016–1020.

Liang,M.G.,Heidelberg,K.A.,Jacobson,R.M.,McEvoy,M.T.,1998.

Herpes zoster after varicella immunization.J.Am.Acad.Dermatol.

38,761–763.

Loparev,V.N.,Argaw,T.,Krause,P.R.,Takayama,M.,Schmid,D.S., 2000a.Improved identi?cation and differentiation of varicella-zoster virus(VZV)wild-type strains and an attenuated varicella vaccine strain using a VZV open reading frame62-based PCR.J.Clin.Microbiol.

38,3156–3160.

Loparev,V.N.,McCaustland,K.,Holloway,B.P.,Krause,P.R.,Takayama, M.,Schimd,D.S.,2000b.Rapid genotyping of varicella-zoster virus vaccine and wild-type strains with?uorophore-labeled hybridization probes.J.Clin.Microbiol.38,4315–4319.

Martin,J.H.,Dohner, D.E.,Wellinghoff,W.J.,Gelb,L.D.,1982.Re-striction endonuclease analysis of varicella-zoster vaccine virus and wild-type DNAs.J.Med.Virol.9,69–72.

Safronetz,D.,Humar,A.,Tipples,G.A.,2003.Differentiation and quan-titation of human herpesviruses6A,6B and7by real-time PCR.J.

Virol.Methods112,99–105.

Shiraki,K.,Horiuchi,K.,Asano,Y.,Yamanishi,K.,Takahashi,M.,1991.

Differentiation of Oka vaccine strain from wild varicella-zoster virus strains isolated from vaccines and household contact.J.Med.Virol.

33,128–132.

Takahashi,M.,Plotkin,S.A.,2000.Development of the Oka vaccine.In: Arvin,A.M.,Gershon,A.A.(Eds.),Varicella-Zoster Virus:Virology and Clinical Management.Cambridge University Press,Cambridge, UK,pp.442–459.

Tipples,G.A.,Stephens,G.M.,Sherlock,C.,Bowler,M.,Hoy,B.,Cook,

D.,Grose,C.,2002.A new variant of varicella-zoster virus.Emerg.

Infect.Dis.8,1504–1505.

White,C.J.,1996.Clinical trials of varicella vaccine in healthy children.

Infect.Dis.Clin.N.Am.10,595–608.

White,C.J.,1997.Varicella zoster virus vaccine.Clin.Infect.Dis.24, 753–763.