烟粉虱介绍

F

o

r R e v

i e

w

O n l y

Assessment of the Bemisia tabaci CYP6CM1vQ transcript

and protein levels in laboratory and field-derived imidacloprid resistant insects, and cross–metabolism

potential of the recombinant enzyme

Journal: Insect Science

Manuscript ID: INS-2010-06-160.R1

Wiley - Manuscript type: Special Issue Date Submitted by the

Author:

16-Sep-2010

Complete List of Authors: Roditakis, Emmanouil; National Agricultural Research Foundation,

Heraklion (N.AG.RE.F.), Plant Protection Institute of Heraklion, Morou, Evangelia; University of Crete,, Biology

Tsagkarakou, Anastasia; National Agricultural Research Foundation, Heraklion (N.AG.RE.F.), Plant Protection Institute of Heraklion, Riga, Maria; University of Crete,, Biology Nauen, Ralf; Bayer, CropScience

Paine, Mark; Liverpool School Tropical Medicine, Vector Group Morin, Shai; Hebrew University of Jerusalem, Entomology Vontas, John; University of Crete, Biology

Keywords:

recombinant P450, diagnostics, neonicotinoids, peptide antibodies, detoxification

Abstract:

Overexpression of the cytochrome P450 CYP6CM1 gene has been associated with Imidacloprid resistance in a number of Q and B

biotype Bemisia tabaci laboratory strains from distinct geographical origin worldwide. We recently demonstrated that the Q biotype version of the CYP6CM1 protein (CYP6CM1vQ) is capable of metabolizing imidacloprid. Here, we showed that the levels of

BtCYP6CM1vQ were also elevated in laboratory resistant strains and field-derived populations, with variable imidacloprid resistance levels, collected in Crete. High levels of CYP6CM1vQ transcripts

were also determined in survivors of a heterogeneous field

population, after exposure to discriminating imidacloprid dosage. Using peptide antibody-based detection assays, we demonstrated that in line with transcriptional data, the CYP6CM1vQ protein levels were higher in imidacloprid resistant insects, which further implicates the gene as the causal factor of resistance. Finally, assessment of the cross–metabolism potential of CYP6CM1vQ

against additional neonicotinoid molecules used for B. tabaci control revealed that clothianidin and thiacloprid, but not acetamiprid or

Insect Science

F o

r R e v i e w

O n l y

thiamethoxam, are metabolised by the recombinant enzyme in

vitro.

Page 1 of 17Insect Science

F o

r R

e v i e w

O

n l

y

1

2 Assessment of the Bemisia tabaci CYP6CM1vQ transcript and protein

3 levels in laboratory and field-derived imidacloprid resistant insects,

4 and cross–metabolism potential of the recombinant enzyme

5

6 Emmanouil Roditakis a*, Evangelia Morou b,c*, Anastasia Tsagkarakou a , Maria

7 Riga b , Ralf Nauen d , Mark Paine c , Shai Morin e and John Vontas b￥

8 9 a

Laboratory of Entomology and Agricultural Zoology, Plant Protection Institute of

10 Heraklion, National Agricultural Research Foundation, Heraklion (N.AG.RE.F.), 11 Kastorias 32A Katsampas, 71003 Heraklio, Greece

12 b

Faculty of Applied Biology and Biotechnology, Department of Biology, University of

13 Crete, 71409 Heraklion, Greece

14 c

Vector Group, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool, L3

15 5QA

16 d

Bayer CropScience AG Research Insecticides Insect Toxicology and Resistance

17 Building 6220 Alfred Nobel Str. 50 D-40789 Monheim Germany

18 e

Department of Entomology, Faculty of Agricultural, Food and Environmental Quality

19 Sciences, Hebrew University of Jerusalem, P.O.Box 12, Rehovot 76100, Israel

20 21

22 * equal authors

23 ￥

Address for correspondence: e-mail: vontas@imbb.forth.gr, Fax:2810394408,

24 Tel:302810394077 25

26 Running title: P450- neonicotinoid resistance in Bemisia tabaci

27

Page 2 of 17

Insect Science

F o

r R

e v i e w

O n l y

28 Abstract

29 Over-expression of the cytochrome P450 CYP6CM1 gene has been associated with 30 Imidacloprid resistance in a number of Q and B biotype Bemisia tabaci laboratory 31 strains from distinct geographical origin worldwide. We recently demonstrated that the 32 Q biotype version of the CYP6CM1 protein (CYP6CM1vQ) is capable of metabolizing 33 imidacloprid. Here, we showed that the levels of BtCYP6CM1vQ were also elevated in 34 laboratory resistant strains and field-derived populations, with variable imidacloprid 35 resistance levels, collected in Crete. High levels of CYP6CM1vQ transcripts were also 36 determined in survivors of a heterogeneous field population, after exposure to 37 discriminating imidacloprid dosage. Using peptide antibody-based detection assays, we 38 demonstrated that in line with transcriptional data, the CYP6CM1vQ protein levels were 39 higher in imidacloprid resistant insects, which further implicates the gene as the causal 40 factor of resistance. Finally, assessment of the cross–metabolism potential of 41 CYP6CM1vQ against additional neonicotinoid molecules used for B. tabaci control 42 revealed that clothianidin and thiacloprid, but not acetamiprid or thiamethoxam, are 43 metabolised by the recombinant enzyme in vitro . 44 45 46

47 Keywords: neonicotinoids, peptide antibodies, detoxification, P450

48

Page 3 of 17Insect Science

F o

r R

e v i e w

O

n l

y

Introduction

49 The whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) is one of the most damaging 50 pests of numerous crops world-wide. It has recently become a major pest in Crete (50% 51 of total greenhouse area of Greece) being responsible for significant yield losses in 52 protected and field crops (Roditakis et al., 2009). As a result of intensive use of 53 chemical insecticides, such as organophosphates and pyrethroids, many of those no 54 longer effectively control B. tabaci , due to the appearance of insecticide-resistant 55 populations (Roditakis et al., 2005).

56 Neonicotinoids, such as imidacloprid, acetamiprid, thiamethoxam, thiacloprid and 57 clothianidin (Elbert et al., 2008) have been more recently introduced for the control of 58 B. tabaci and several other major agricultural pests. Neonicotinoids are nicotinic 59 acetylcholine receptor (nAChR) agonist, that combine high potency with low 60 mammalian toxicity (Tomizawa and Casida, 2005) and are generally resilient to 61 insecticide resistance selection. Imidacloprid has a crucial role in the control of B. 62 tabaci in Crete and many other regions worldwide. However, resistance against this 63 molecule has been recently identified as an emerging problem. It was first detected in 64 southern Spain (Cahill et al., 1996) and it is now widely spread worldwide in both B 65 and Q B. tabaci biotypes (Nauen and Denholm, 2005). We recently monitored variable 66 levels of imidacloprid resistance in a number of field populations collected from 67 greenhouses and outdoor crops in Crete, during a large scale survey (Roditakis et al., 68 2009).

69 Biochemical examinations revealed that imidacloprid resistance in B. tabaci is 70 associated

with

enhanced

oxidative

detoxification

by cytochrome

P450

71 monooxygenases (Rauch and Nauen, 2003). The constitutive over-expression of the 72 cytochrome P450 CYP6CM1vQ , was strongly correlated with the phenotype in several 73 laboratory selected strains of both B and Q B. tabaci biotypes (Karunker et al., 2008). In 74 a more recent study, we reconstituted a functional monooxygenase complex and showed 75 that the recombinant CYP6CM1vQ enzyme has the potential to metabolize imidacloprid 76 to its 5-hydroxy form with a relatively high conversion rate (Karunker et al., 2009) and 77 thus probably cause the resistance phenotype, assuming that increased transcripts levels 78 indicates also increment in enzyme production.

79

Page 4 of 17

Insect Science

F o

r R

e v i e w

O

n l y

The cross resistance potential of imidacloprid resistance has been investigated in several 80 laboratory strains (Prabhaker et al., 2005; Wang et al., 2009). Imidacloprid-resistant Q-81 type B. tabaci strains collected from Spain, Italy, Germany and Greece have been 82 reported to show high cross-resistance to other neonicotinoids including thiamethoxam 83 and acetamiprid (Nauen et al., 2002). B-type strain (ISR-02) collected from greenhouse 84 roses in Israel in 2002 had high levels of resistance to imidacloprid and thiamethoxam 85 (874-, >900- fold respectively), but moderate resistance levels against acetamiprid (78-86 fold). However, a strain with 120-fold resistance collected from California (IM-R) did 87 not show cross-resistance to acetamiprid, dinotefuran or thiamethoxam, and a B-type 88 strain from Guatemala with 109-fold resistance to imidacloprid (GU-R) showed low 89 levels of cross resistance when bioassayed with acetamiprid and thiamethoxam 90 (Prabhaker et al., 2005). Although elevated P450s activities has been associated with 91 imidacloprid resistance in most cases analyzed to-date, the exact contribution of 92 CYP6CM1vQ to the resistant phenotype and its association with the relatively variable 93 cross resistance pattern reported remains unknown. Many P450s catalyze a highly 94 restricted set of reactions, but some are capable of metabolizing a very wide range of 95 compounds. In addition, cytochrome P450 that are very similar in sequence can have 96 dramatically different insecticide-metabolism profiles (Chiu et al., 2008). 97 In this paper, we have determined the CYP6CM1vQ transcripts and protein levels in 98 laboratory and field-derived imidacloprid resistant B. tabaci from Crete, and assessed 99 the cross–metabolism potential of recombinant BtCYP6CM1vQ against additional 100 neonicotinoid molecules. 101

102 Materials and Methods

103 Insects

104 The B. tabaci strain SUD-S (Sudan, 1978) was obtained by IACR Rothamsted, UK and 105 used as a reference susceptible strain. GR-IMI was isolated from Malades (Crete, 2005) 106 and selected with imidacoprid for six generations at approximately LD70 (gradually 107 elevating imidacloprid concentrations ranging from 100 to 600ppm). Field populations 108 used in this study (codes: “146”, “151”, “153”, “176”, “164”) are described in detail 109 (collection site/date and crop, insecticide spraying history, resistance status, levels of 110 biochemical resistance markers) in Roditakis et al (2009). Insects were maintained on

111

Page 5 of 17Insect Science

F o

r R

e v i e w

O

n l

y

cotton plants in an insect proof cage in a growth chamber at 25 (±1)?C, 50–60% RH and 112 a photoperiod 16:8 h light: dark. 113 114 Bioassays

115 A previously described procedure was used for the bioassays (Roditakis et al., 2005). 116 Briefly, a cotton leaf disc was immersed for 5 sec in aqueous solution of insecticide 117 containing 0.2 g litre -1 Triton X-100 (Merck, Germany), allowed to dry and placed on a 118 Petri dish embedded with thin sterile water agar. Twenty females were placed on each 119 leaf disc and the dishes were inverted for the insects to orientate normally and placed in 120 a large controlled environment room. Mortality data were recorder 72 hours later and 121 analyzed by probit (Probit software 3.3, Praxeme, by Raymond et al., 1993). Two 122 synergists, piperonyl butoxide (PB, Sigma, UK) and S,S,S-tributyl phosphorotrithioate 123 (DEF, Sigma, UK), applied via a tarsal contact method were included in the bioassay 124 experiment. Briefly, inner surfaces of 30 ml glass scintillation vials were coated by 125 rolling with 0.1 % PB or 2% DEF (v/v) in acetone and batches of 35 insects were pre-126 exposed to synergists for 4 h. After one hour interval insecticides were applied.

127

128 Cytochrome P450-activity assay

129 Approximately 400 adults were homogenized in 1 ml of sodium/potassium phosphate 130 buffer, pH 7.6 containing 1 mM EDTA, 1 mM dithiothreitol and 200 mM sucrose. The 131 homogenates were centrifuged at 5,000 g for 10 min at 4o C, the resulting supernatant at 132 15,000 g for 15 min and then again at 100,000 g for 1 h at 4o C, to obtain the 133 microsomal pellet, which was re-suspended in the same buffer and used to determine 134 Ethoxycoumarin O-deethylase (ECOD) activity, as previously described (Roditakis et 135 al., 2006). A unit correspond to the formation of 1 pmol 7-hydroxycoumarin per 136 minute/μg microsomal protein. 137

138 RNA isolation and cDNA synthesis

139 Total RNA was isolated using TRI reagent (Sigma) according to manufacturer’s 140 instructions. The RNA was treated with DNase RQ1 (Promega) to remove any 141 contaminating genomic DNA. First-strand cDNA was synthesized from total RNA

142

Page 6 of 17

Insect Science

F o

r R

e v i e w

O

n l

y

using SuperScript II RNase H reverse transcriptase (Invitrogen) and an oligo(dT) 143 adaptor primer [5’-GACTCGAGTCGATCGA (-dT)17-30] as described in the 144 manufacturer’s protocol. 145 146

147 Real time PCR

148 Gene-specific primers were designed to amplify ~200 bp fragments of CYP6CM1vQ 149 (qCYP6A14F:

5’TCCAGCTTCTCTGGCAGATT3’,

qCYP6A14R:

150 5’TATCACCGATGGCTCTCTCC3’, and

actin

(qactinF: 151 5’TCAGGGTGTAATGGTCGGTA3’,

qactinR:

152 5’TGATGATACCGTGCTCGATGG3’) for the real-time PCR experiments. 153 Incorporation of the fluorescent dye SYBR Green (Quantitect SYBR Green qPCR mix, 154 Qiagen) into double-stranded PCR products was used to determine mRNA copy 155 number. Standard plasmids were constructed by inserting fragments from the coding 156 region of each gene amplified from cDNA, into the pGEM T-easy vector (Promega 157 UK). These plasmids were utilized as template DNA at concentrations ranging from 1 158 ng to 10 fg to produce standard curves on an Opticon Lightcycler (Bio-Rad, UK) in 159 accordance with the manufacturer’s recommended protocols. A portion of the cDNA 160 (~1%) obtained from fifty insects was used as a template for each quantification. Thirty-161 five rounds of amplification were performed using 1 × Quantitect SYBR Green PCR 162 mix (Qiagen) and 5 pmol of each primer. The amplification cycle was 95 °C for 10 s, 57 163 °C for 15 s and 72 °C for 15 s. Each sample was analysed in duplicate for each 164 experiment and the means of two biological replicates calculated. The data were 165 quantified with Opticon Monitor Analysis software (MJ Research), and results were 166 expressed as a proportion of analysed gene transcripts to that of the actin internal 167 control. 168

169 Analysis of CYP6CM1vQ structure, selection of antigenic sequence and antibody 170 production

171 In order to design a peptide antibody which corresponds to a surface loop of CYP6CM1 172 (both B and Q versions) we used as a model the structure of human microsomal 173 cytocrome P450 3A4 determined by X-ray crystallography to 2.05A resolution. The

174

Page 7 of 17Insect Science

F o

r R

e v i e w

O

n l

y

structure of CYP3A4 was obtained from the Protein Data Bank (PDB ID:1TQN) and 175 analysed with Swiss PdbViewer 4.0.1. The chosen 15 aa synthetic peptide 176 (KSEKASKTDAGNDTC) had good hydrophilicity and low homology with other 177 members of the P450 family and is located close to the C terminus of CYP6CM1 both B 178 and Q versions). The peptide was synthesised using a semi-automated peptide 179 synthesiser (NovaBiochem). Antibodies were raised against peptide conjugates in New 180 Zealand White rabbits. The purification of the crude antibody was carried out with the 181 following procedure: The 15aa peptide was initially treated with Immobilised TCEP 182 disulfide reducing gel (PIERCE) in order to reduce peptide’s disulfide bonds and then it 183 was coupled with the Sulfolink coupling gel (PIERCE). The crude antibody (0.3ml) was 184 loaded on the column and incubated with the coupling gel for 1hour at RT. The column 185 was washed with 12ml PBS and the purified antibody was eluted with 4 ml elution 186 buffer (0.1M glycine HCL, pH 2.5-3.0). The eluted antibody was neutralised with 1M 187 sodium phosphate buffer, pH 8.8. 188

189 Immunoblotting

190 Immunoblotting was performed using 0.05 mg of microsomal protein. Briefly, the 191 proteins were prepared for SDS-polyacrylamide gel electrophoresis (10% acrylamide 192 running gel and 4% acrylamide stacking gel) and electroblotted onto PVDF 193 (polyvinylidene difluoride) membrane. After blocking the PVDF membrane with 5% 194 skimmed milk in PBS-Tween buffer, it was developed for immunoreactivity by 195 overnight exposure at 4o C to the purified polyclonal anti Btcyp6 antibody (1:250 196 dilutions in 3% skimmed milk in PBS-Tween buffer). Antibody binding was detected 197 using goat antirabbit IgG coupled to horseradish peroxidase (diluted 1:10.000 in 3% 198 skimmed milk in PBS-Tween buffer) and visualised using a horseradish peroxidase 199 sensitive ECL chemiluminescent Western blotting kit (GE Healthcare) and the result 200 was recorded on Hyperfilm. 201

202 Functional expression of CYP6CM1vQ

203 Competent E. coli DH5a cells were co-transformed with pCW_CYP6CM1vQ and an 204 expression vector (pACYC-AgCPR) containing cytochrome P450 reductase from 205 Anopheles gambiae (AgCPR, GenBank AY183375) and peIB signal sequence

206

Page 8 of 17

Insect Science

F o

r R

e v i e w

O

n l

y

(Mclaughlin et al., 2008), as previously described (Karunker et al., 2009). Cultures were 207 grown until the appearance of P450 in the CO-reduced spectra of whole cells (w24 h), a 208 point at which the cells were harvested. Spheroplasts were prepared as previously 209 described (Karunker et al., 2009), and the resulting membranes were diluted in TSE 210 buffer and stored at -70o C until required. P450 content was measured in reduced 211 samples by CO-difference spectra – (Omura and Sato, 1964). The activity of CPR was 212 estimated by measurements of NADPH-dependent reduction of cytochrome c at 550 nm 213 (Pritchard et al., 2006). Purified recombinant A. gambiae cytochrome b5 (AgCytb5, GB 214 AY183376) was prepared as previously described and was included in all reactions 215 (Karunker et al., 2009). Total protein concentration was determined by Bradford assay 216 (Bradford, 1976) using bovine serum albumin standards. 217

218 Insecticide metabolism assays

219 Neonicotinoids (>98% technical, Bayer Cropscience) were incubated with bacterial 220 membranes containing 0.5 mM of CYP6CM1vQ and approximately 3 mM b5 in 100 ml 221 Tris–HCl buffer (0.2 M, pH 7.4) containing 0.25 mM MgCl 2. The incubation was 222 performed in the presence or absence of NADPH generating system: 1 mM glucose-6-223 phosphate (Melford), 0.1 mM NADP (Melford), 1 unit ml -1 glucose-6-phosphate 224 dehydrogenase (G6PDH). Reactions were carried out at 30 o C with 1200 rpm shaking. 225 Samples were pre-warmed for 5 min before reactions were initiated by the addition of 226 membrane preparations. Reactions were stopped at 60 min with 100 ml of acetonitrile 227 and incubated for further 20 min to ensure that all insecticide was dissolved. The 228 quenched reactions were centrifuged at 20,000 g for 5 min before transferring the 229 supernatant to glass HPLC vials. 100 ml of the supernatant was injected at a flow rate of 230 1 ml min -1 at 23 o C. Neonicotinoids and their metabolites were separated on a 250 mm 231 C18 column (Acclaim 120, Dionex), as previously described (Karunker et al., 2009). 232

233 Results and discussion

234 CYP6CM1vQ -based imidacloprid resistance in laboratory selected strain and field 235 caught Q Biotype Bemisia tabaci populations from Crete

236

Page 9 of 17Insect Science

F o

r R

e v i e w

O

n l

y

In line with previous reports (Roditakis et al., 2009), relatively high levels of 237 imidacloprid resistance were identified in Q Biotype B. tabaci whiteflies from Crete. 238 Resistance ratio scaled up to 958-fold in the GR-IMI strain, derived from a field 239 population and subjected to mild laboratory selection with imidacloprid. Cytochrome 240 P450 activity, with the substrate ethoxycoumarin was significantly elevated (from 0.12 241 to 0.89 units) in the GR-IMI strain, while imidacloprid toxicity was increased more than 242 19-fold (LC 50 reduced from 345 to 17.8 mg/l) by pre-exposure to PB (Table 1), 243 suggesting that cytochrome P450(s) are mainly responsible for the reduced 244 susceptibility against imidacloprid. The expression of CYP6CM1vQ , previously 245 associated with imidacloprid resistance in laboratory selected populations from distinct 246 geographical regions, was analysed using real-time quantitative RT-PCR in the GR-IMI 247 strain, as well as in previously bio-assayed field populations from Crete with variable 248 resistance levels. The constitutive expression of CYP6CM1vQ was highly correlated 249 with resistance to imidacloprid in the GR-IMI and the field populations analysed 250 (Figure 1). In addition, CYP6CM1vQ mRNA accumulation was higher in the survivors 251 of a heterogeneous population (“164”, Roditakis et al 2009), two days after exposure to 252 a discriminative dosage of imidacloprid (Figure 1), which further indicates the 253 association of gene with the resistance phenotype. 254

255 Accumulated levels of CYP6CM1vQ transcripts lead to increased enzyme production in

256 imidacloprid resistant whiteflies

257 In order to test this assumption, that accumulated levels of CYP6CM1vQ transcripts lead 258 to increased enzyme production in imidacloprid resistant whiteflies, we performed 259 Western blot analysis, using microsomal preparations probed with anti-CYP6CM1 260 antiserum. The antiserum was raised against the peptide KSEKASKTDAGNDTC, 261 which was designed on antigenic and non conserved sequence C terminus of the 262 CYP6CM1vQ protein. Α single band of approximately 60 kDa was detected in all 263 strains, with intensity levels highly correlated with the levels of CYP6CM1vQ 264 transcripts and imidacloprid resistance. This finding indicates that elevated 265 CYP6CM1vQ transcripts lead to increased enzyme levels in imidacloprid resistant 266 strains and further emphasizes the likely involvement of the gene in resistance.

267

Page 10 of 17

Insect Science

F o

r R

e v i e w

O

n l

y

In addition, we explored the potential of the peptide antibody based assay, to diagnose 268 elevated levels of the CYP6CM1vQ protein in crude whitefly homogenates, and 269 possibly ELISA diagnostics. However, detection of the protein was hardly visible in any 270 of the crude homogenates tested (data not shown). 271

272 Cross–metabolism potential of recombinant CYP6CM1vQ

273 The isolated bacterial membranes of the functional monooxygenase contained 0.3 nmol 274 P450/mg CYP6CM1vQ protein, 5μM b5, and P450 reductase activity in the range of 275 200 nmol cytochrome c reduced/min/mg protein. NADPH-dependent depletion of 276 imidacloprid and paralleled formation of the 5-hydroxy imidacloprid, was observed 277 after incubating the compound with the P450 complex. Imidacloprid depletion and 278 metabolite peak formation were time-dependent, and approximately 40% of the total 279 compound was metabolized within 60 min. Incubations carried out in the absence of a 280 NADPH regenerating system showed no change in the control chromatogram of the 281 parental imidacloprid molecule. We subsequently examined the metabolic efficiency of 282 CYP6CM1vQ against a number of neonicotinoids, that have been used for the control of 283 B. tabaci . Clothianidin and thiacloprid were also metabolized by CYP6CM1vQ in an 284 NADPH and time dependent manner and approximately 70% of the total clothianidin 285 and 50% of the total thiacloprid included in the assay was metabolized within 60 min, 286 respectively. These findings were in line with previous bioassay studies which showed 287 cross resistance potential of imidacloprid resistance with these neonicotinoids ((Nauen 288 et al., 2002). However, no metabolic activity was observed against acetamiprid or 289 thiamethoxam, after 60 min incubation with 0.4 nmol P450/mg recombinant enzyme 290 CYP6CM1vQ, under assay conditions, although cross resistance to these compounds 291 was also reported in imidacloprid resistant strains (Nauen et al., 2002). The operation 292 of additional neonicotinoid resistance mechanisms cannot be excluded. 293

294 Concluding remarks

295 In line to previous studies, we showed that high levels of imidacloprid resistance were 296 associated with over-expression of CYP6CM1vQ in Q biotype B. tabaci laboratory 297 strains and field populations from Crete. High levels of CYP6CM1vQ transcripts were 298 also determined in survivors of a heterogeneous field population, after exposure to

299

Page 11 of 17Insect Science

F o

r R

e v i e w

O n l y

discriminating imidacloprid dosage, indicating a possible operating impact of the 300 CYP6CM1vQ-based resistance mechanism on B. tabaci control in the field.

301 Using specific peptide antibodies successfully produced against the CYP6CM1 (both Q 302 and B biotypes), and immunoblotting of the microsomal fraction, we demonstrated that 303 in line to transcriptional data, the CYP6CM1vQ protein levels were higher in the 304 imidacloprid resistant insects, which further emphasizes the role of the accumulated 305 transcripts of CYP6CM1vQ in imidacloprid resistance in B. tabaci . Aiming to develop a 306 specific ELISA test for detecting CYP6CM1vQ-based resistance, we also tested the 307 specific antibodies against crude homogenates of B. tabaci . However, the signal (band 308 intensity) was hardly visible by eye and didn’t allow protein quantification, using 309 standard protein detection techniques (data not shown).

310 Finally, assessment of the cross–metabolism potential of CYP6CM1vQ against 311 additional neonicotinoid molecules showed that clothianidin and thiacloprid, but not 312 acetamiprid or thiamethoxam, are metabolised by the recombinant enzyme in vitro . This 313 finding is in agreement with some previous studies that showed low levels of cross 314 resistance among neonicotinoids (Prabhaker et al., 2005), but not with others that 315 demonstrated high cross-resistance levels (Nauen et al., 2002).

316 317

318 Acknowledgements

319 This research was supported by grants from Bayer Crop Science and Hellenic 320 Secretariat General for Research and Technology (Vioalevrioi, to J.V.) and The Royal 321 Society to MP and JV. We thank Dimitra Tsakireli (University of Crete) for her help in 322 the functional expression of the CYP6CM1vQ. 323

324

Page 12 of 17

Insect Science

F o

r R

e v i e w

O

n l

y

References

325

326 Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of

327 microgram quantities of protein utilizing the principle of protein dye binding . 328 Analytical Biochemistry , 72, 248-254.

329 Cahill, M., Gorman, K., Day, S., Denholm, I., Elbert, A. and Nauen, R. (1996)

330 Baseline determination and detection of resistance to imidacloprid in Bemisia 331 tabaci (Homoptera: Aleyrodidae). Bulletin of Entomological Research , 86, 332 343-349.

333 Chiu, T.-L., Wen, Z., Rupasinghe, S.G. and Schuler, M.A. (2008) Comparative

334 molecular modeling of Anopheles gambiae CYP6Z1, a mosquito P450 capable 335 of metabolizing DDT . Proceedings of the National Academy of Sciences , 105, 336 8855-8860.

337 Elbert, A., Haas, M., Springer, B., Thielert, W. and Nauen, R. (2008) Applied aspects

338 of neonicotinoid uses in crop protection . Pest Management Science , 64, 1099-339 1105.

340 Karunker, I., Benting, J., Lueke, B., Ponge, T., Nauen, R., Roditakis, E., Vontas, J.,

341 Gorman, K., Denholm, I. and Morin, S. (2008) Over-expression of

342 cytochrome P450 CYP6CM1 is associated with high resistance to imidacloprid 343 in the B and Q biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect 344 Biochemistry and Molecular Biology , 38, 634-644.

345 Karunker, I., Morou, E., Nikou, D., Nauen, R., Sertchook, R., Stevenson, B.J., Paine,

346 M.J.I., Morin, S. and Vontas, J. (2009) Structural model and functional 347 characterization of the Bemisia tabaci CYP6CM1vQ, a cytochrome P450

348 associated with high levels of imidacloprid resistance . Insect Biochemistry and 349 Molecular Biology , 39, 697-706.

350 Mclaughlin, L.A., Niazi, U., Bibby, J., David, J.-P., Vontas, J., Hemingway, J.,

351 Ranson, H., Sutcliffe, M.J. and Paine, M.J.I. (2008) Characterization of 352 inhibitors and substrates of Anopheles gambiae CYP6Z2. Insect Molecular 353 Biology , 17, 125-135.

354 Nauen, R. and Denholm, I. (2005) Resistance of insect pests to neonicotinoid

355 insecticides: Current status and future prospects . Archives of Insect 356 Biochemistry and Physiology , 58, 200-215.

357 Nauen, R., Stumpf, N. and Elbert, A. (2002) Toxicological and mechanistic studies on

358 neonicotinoid cross resistance in Q-type Bemisia tabaci (Hemiptera : 359 Aleyrodidae). Pest Management Science , 58, 868-875.

360 Omura, T. and Sato, R. (1964) The Carbon Monoxide-binding Pigment of Liver

361 Microsomes . Journal of Biological Chemistry , 239, 2370-2378.

362 Prabhaker, N., Castle, S., Henneberry, T.J. and Toscano, N.C. (2005) Assessment of

363 cross-resistance potential to neonicotinoid insecticides in Bemisia tabaci 364 (Hemiptera: Aleyrodidae). Bulletin of Entomological Research , 95, 535-543. 365 Pritchard, M.P., Mclaughlin, L.A. and Friedberg, T. (2006) Establishment of

366 Functional Human Cytochrome P450 Monooxygenase Systems in Escherichia 367 coli . Methods in Molecular Biology, vol 320 - Cytochrome P450 Protocols, 368 Second Edition (eds I.R. Phillips & E.A. Shephard), pp. 19-29. Humana Press 369 Inc, Totowa, NJ

370 Rauch, N. and Nauen, R. (2003) Identification of biochemical markers linked to

371 neonicotinoid cross resistance in Bemisia tabaci (Hemiptera : Aleyrodidae). 372 Archives of Insect Biochemistry and Physiology , 54, 165-176.

373

Page 13 of 17Insect Science

F o

r R

e v i e w O n l y

Raymond, M., Prato, G. and Ratsira, D. (1993) Probit analysis of mortality assays

374 displaying quantal response . Version 3.3 License 193019.

375 Roditakis, E., Grispou, M., Morou, E., Kristoffersen, J.B., Roditakis, N.E., Nauen, R.,

376 Vontas, J. and Tsagkarakou, A. (2009) Current status of insecticide resistance 377 in Q biotype Bemisia tabaci populations from Crete . Pest Management 378 Science , 65, 313-322.

379 Roditakis, E., Roditakis, N.E. and Tsagkarakou, A. (2005) Insecticide resistance in

380 Bemisia tabaci (Homoptera : Aleyrodidae) populations from Crete . Pest 381 Management Science , 61, 577-582.

382 Roditakis, E., Tsagkarakou, A. and Vontas, J. (2006) Identification of mutations in the

383 para sodium channel of Bemisia tabaci from Crete, associated with resistance 384 to pyrethroids . Pesticide Biochemistry and Physiology , 85, 161-166. 385 Tomizawa, M. and Casida, J.E. (2005) Neonicotinoid insecticide toxicology:

386 Mechanisms of selective action . Annual Review of Pharmacology and 387 Toxicology , 45, 247-268.

388 Vontas, J.G., Enayati, A.A., Small, G.J. and Hemingway, J. (2000) A simple

389 biochemical assay for glutathione S-transferase activity and its possible field 390 application for screening glutathione S-transferase-based insecticide 391 resistance . Pesticide Biochemistry and Physiology , 68, 184-192.

392 Wang, Z., Yao, M. and Wu, Y. (2009) Cross-resistance, inheritance and biochemical

393 mechanisms of imidacloprid resistance in B-biotype Bemisia tabaci. Pest 394 Management Science , 65, 1189-1194.

395

396

Page 14 of 17

Insect Science

F o

r R

e v i e w

O

n l

y

397 398 Figure Legends

399

400

401 Figure 1. The expression levels of CYP6CM1vQ compared to imidacloprid

402 resistance (Resistance Ratio) in Bemisia tabaci from Crete.

403 The expression levels of CYP6CM1vQ in imidacloprid resistant strain GR – IMI and 404 field populations from Crete (“146”, “151”, “153”, “176”, “164”) described in details 405 (collection site/date and crop, insecticide spraying history, resistance status, levels of 406 biochemical resistance markers) in Roditakis et al (2009). Expression levels were also 407 determined in survivors (“164 Surv”) after exposure of a non homogeneous field 408 population (164) to high discriminating imidacloprid dosage. Y axis: normalised for 409 actin cyp6a14 expression ratio, compared to SUDs.

410 411

412 Figure 2. Relative levels of CYP6CM1vQ protein in Bemisia tabaci 413 with variable resistance levels to imidacloprid

414 As shown in commassie staining (down), equal amounts of microsomal protein from 415 the samples were applied to each lane. The blot (up) was developed with an 416 antipeptide antibody targeted against the CYP6CM1 protein under the conditions

417 described in the Methods section. 418

419

420

Page 15 of 17Insect Science

F o

r R

e v

i e w

O n

l y

15

Table 1. The response of the resistant Bemisia tabaci strain GR-IMI to imidacloprid alone or after synergistic exposure.

Strain Insecticide n

LC 50 (mg L -1) 95% CL Slope SE X 2 a RR Sud-S imidacloprid 578 0.36 0.24 - 0.53 1.04 0.10 5.4 - GR-MAL-RN imidacloprid 213 345 203 - 715 1.24 0.28 2.2 958 imidacloprid + DEF 277 261 180 – 421 1.54 0.28 4.1 727 imidacloprid + PB

222

17.8

6.47 - 34.5 0.67 0.13

2.4

49

n, number of whiteflies tested. CL, confidence limits. RR, resistance ratio. a

Chi square testing linearity of dose-mortality response

Page 16 of 17

Insect Science

Page 17 of 17Insect Science

F

o

r

R

e

v

i

e

w

O

n

l

y

F o

r R e v i e w

O n l y

Page 18 of 17

Insect Science