StPRp27, contributes to race-nonspecific resistance against Phytophthora infestans

A potato pathogenesis-related protein gene,StPRp27,contributes to race-nonspeci?c resistance against Phytophthora infestans

Xiaolei Shi ?Zhendong Tian ?Jun Liu ?

Edwin A.G.van der Vossen ?Conghua Xie

Received:28February 2011/Accepted:25May 2011óSpringer Science+Business Media B.V.2011

Abstract Late blight caused by Phytophthora infestans is the most important disease of potato.Many efforts have been made to understand molecular mechanism of the durable resistance to address the challenge raised by rapid evolution of the pathogen.A pathogenesis related protein (PR)gene StPRp27was previously isolated from the potato leaves challenged by P.infestans .The sequence analysis and expression pattern reveal that StPRp27may be asso-ciated with resistance to P.infestans .In present research,transient expression of StPRp27in Nicotiana benthamiana enhanced resistance to P.infestans isolates 99189and PY23indicating its potential contribution to the disease resistance.These ?ndings were also con?rmed by over-expression of StPRp27in potato cv.E-potato 3,which signi?cantly slowed down the development of the disease

after inoculation with a mixture of P .infestans races.Further,silencing of StPRp27homologous genes in N.benthamiana harboring dominant Phytophthora resis-tance gene Rpi-blb1or Rpi-blb2showed no effects on the resistance triggered by these R genes.Our results suggest that StPRp27contributes to a race-nonspeci?c resistance against P.infestans by inhibiting the disease development and has a potential use in selection and breeding for durable resistance to late blight.

Keywords Pathogenesis-related protein á

Phytophthora infestans áPotato áStPRp27gene Abbreviations HR Hypersensitive response PR protein Pathogenesis-related protein TRV Tobacco rattle virus VIGS Virus induced gene silencing

Introduction

Late blight,one of the most destructive disease of potato (Solanum tuberosum L.),is caused by Phytophthora infe-stans (Mont.)de Bary.Today P.infestans causes enormous economic losses in potato production,making it an important pathogen threatening global food security.Two forms of genetic resistance to P.infestans in potato have been classi?ed as race-speci?c (qualitative)and race-non-speci?c (quantitative)resistance.The race-speci?c resis-tance is associated with dominant resistance (R )genes,the protein of which speci?cally recognizes the pathogen avirulence (AVR)protein to trigger plant defense mobili-zation,mostly leading to a hypersensitive response (HR)[1].Recent studies demonstrated that regulatory genes,

Xiaolei Shi and Zhendong Tian contributed equally to this work.

Electronic supplementary material The online version of this

article (doi:10.1007/s11033-011-0937-5)contains supplementary material,which is available to authorized users.

X.Shi áZ.Tian áJ.Liu áC.Xie (&)

Key Laboratory of Horticultural Plant Biology (Huazhong

Agricultural University),Ministry of Education,National Center for Vegetable Improvement (Central China),Potato Engineering and Technology Research Center of Hubei Province Huazhong,Agricultural University,Wuhan,Hubei 430070,People’s Republic of China e-mail:xiech@https://www.360docs.net/doc/741235107.html,

E.A.G.van der Vossen

Wageningen UR Plant Breeding,16,6700AA Wageningen,Netherlands

e-mail:edwin.van-der-vossen@https://www.360docs.net/doc/741235107.html,

Present Address:

E.A.G.van der Vossen

KeyGene N.V,216,6700AE Wageningen,Netherlands

Mol Biol Rep

DOI 10.1007/s11033-011-0937-5

such as NDR1,EDS1,RAR1,SGT1or HSP90[2–5],are required to mediate R gene triggered resistance pathways. The race-nonspeci?c resistance is expected to be more durable and has a broader spectrum than R gene governed resistance[6].To analyze genetic basis of the quantitative resistance to P.infestans,several quantitative trait loci (QTLs)associated with late blight resistance have been identi?ed in different segregation populations of potato [7–9].Further molecular studies focusing on quantitative resistance have demonstrated that challenging potato leaves with P.infestans leads to extensive differential gene expression in potato.Many of these differentially expres-sed genes associate with metabolism,plant defense and signaling and transcriptional regulation,suggesting involvement of some known processes of plant defense response to pathogens[10,11].

The plant defense is particularly characterized by accumulation of pathogenesis-related(PR)proteins.Since the discovery of PRs in1970,PR proteins have been classi?ed into17families based on their coding sequence similarities or biological activities[12].Most PR genes are induced by signaling compounds like salicylic acid(SA), jasmonic acid(JA)or ethylene(ET),and exhibit their activities through structural defenses,antimicrobial activ-ity,and perhaps an involvement in defense signaling pathways.Individual members of PRs seem to play speci?c role in numerous plant-pathogen interactions[12,13]. Although there are extensive studies showing that PRs are associated with plant resistance to pathogen attack and they are widely used as markers of the pathogen induced sys-temic acquired resistance(SAR),speci?c function of many PRs is still unknown[12].

NtPRp27,a member of pathogenesis-related proteins belonging to PR-17family,was found highly accumulated in tobacco in response to TMV infection and other stresses [14].Silencing of NbPRp27(another pathogenesis-related protein gene of PR-17family)in N.benthamiana reduced basal resistance to Pseudomonas syringae pv.Tabaci[15]. These results suggested that individual members of PR-17 family may have diverse function against pathogens in different plant species.However,little information is available about PR-17genes in P.infestans resistance.

In our previous research,a new PR protein gene of potato, StPRp27(GenBank accession number AY185207with ori-ginal name as NtPRp27-like),was cloned and characterized by its deduced amino acids which shares90%similarity with NtPRp27.It was also found that StPRp27was strongly up-regulated by infection of P.infestans in potato[11,16].In this paper,we report the results that StPRp27elevates the resistance to different races of P.infestans by slowing down the disease development both in N.benthamiana and potato. StPRp27may confer broad resistance against P.infestans in potato.Materials and methods

Phytophthora infestans isolates

Phytophthora infestans isolates PY23and99189[17,18] kindly supplied by Wageningen UR Phytopathology and4 races(race1.3.4.7,4.5.7,2.4.11,and2.3.4.8),collected from different locations of Hubei Province,China,where late blight epidemics occur each growing season,were used for the inoculation.The pathogen was cultured on rye and sucrose agar(RSA)medium at18°C.The concentration of sporangia suspension was adjusted to5.09104sporan-gia ml-1for the pathogen inoculation.The phenotypes for resistance to P.infestans were determined by detached leaf assays as described by Vleeshouwers et al.[19].Brie?y, detached leaves that challenged with P.infestans were placed in water-soaked?oral foam and incubated in closed boxes with a layer of dampened paper towel on the base. These containers were placed in chamber room at18°C and 70%relative humidity.The data were collected as indi-cated in relevant experiments.

Transient expression of StPRp27in N.benthamiana

All primers used in this study are indicated in Table1.To construct the pK7WG2-StPRp27plasmid for transient expression of StPRp27in N.benthamiana,the coding region of StPRp27was cloned into the pENTR directional TOPOòvector using primers XL13/XL14(Table1).Sub-sequently,the StPRp27gene was cloned into the Gateway 35S over-expression vector pK7WG2[20]following the manufacturer’s instructions(Invitrogen).The?nal binary construct was transferred into Agrobacterium tumefaciens strain COR308[21]by electroporation transformation. The fourth to sixth fully expanded leaves from the apex of5-week-old N.benthamiana plants were in?ltrated Table1Primers used in the experiments as indicated in the text

Primer name Sequence(50–30)

XL13CACCATGGCTAATAACATTTTCTTC

XL14GTTACGCCCCAAATTTAGCCTTGTA

XL9GTGACGGATCCACACTCGTAGCTGCCACTTC XL10GTGACGGTACCCGGTTACATCGTAGCCTTGG XL7GGCTACGATGTAACCGCTCAATTTC

XL8CAACCGTCTTCCCTAGTAAGTCAAC

XL37ATTGGAAACGGATATGCTCCA

XL38TCCTTACCTGAACGCCTGTCA

XL45CCCATTTCTCAAGCTGTTGCA

XL46GGACCTAGCCACTGGGTGAA

XL49CCAAGCTGACTGTGCTGTCC

XL50AAGCAAGCAATGCGTGCTC

Mol Biol Rep

respectively with A.tumefaciens strains carrying pK7WG2-StPRp27,pBINPLUS-R3a(positive control,R3a gene mediates hypersensitive response to P.infestans isolate 99189),pBINPLUS-Rpi-sto(positive control,Rpi-sto gene mediates hypersensitive response to P.infestans iso-late PY23)and pBINPLUS-abpt(negative control,abpt gene is a non-functional R gene)[22]. A.tumefaciens containing above plasmids were cultured as described by van der Hoorn et al.[23],and their pellets was suspended by the MMA(5g MS salts,1.95g MES,20g sucrose, 200l M acetosyringone,pH5.6),and adjusted to an OD600 of0.1.Two days post agroin?ltration,the in?ltrated leaves were detached and inoculated with P.infestans isolate PY23or99189with10droplets of10l l sporangia sus-pension on both sides of the vein.Each inoculation was replicated three times with nine leaves in each replicate. The disease symptom was measured as percent of foliage infected at8day after inoculation and the data were sta-tistically analyzed with ANOVA using SAS8.0(SAS Institute Inc.).

Over-expression of StPRp27in potato

The coding region of StPRp27was cloned into the Bam HI and Sma I digested plant transformation vector pBI121 by replacing the b-glucuronidase gene to produce35S-StPRp27over-expression vector.The constructs were sub-sequently transferred into A.tumefaciens strain LBA4404. The micro tubers of potato(S.tuberosum)cultivar E-potato 3(E3),which is susceptible to the race mixture collected in China,were used for StPRp27transformation according to the procedure of[24].Putative transformants were con-?rmed through DNA gel blot hybridization using a DIG-labeled neomycin phosphotransferase II(npt II)speci?c probe[25].Two month-old transgenic plants grown in a greenhouse were investigated for their resistance to P.in-festans using the detached leaf assay.Ten lea?ets of the third to?fth fully expanded leaves from the apex of each transgenic line were detached and inoculated with10l l droplet of mixtured P.infestans sporangia suspension. Non-transformed plants were used as control.The largest length and width(perpendicular to the length)of each lesion were measured at time points of3,4,and5days after inoculation.The lesion growth rate(LGR)was cal-culated for each treatment and used to judge the resistance level[19].Three replicates were used for each inoculation. Silencing StPRp27homologous genes

in N.benthamiana containing R gene

A TRV-StPRp27construct was used to silence the StPRp27 gene by exploiting the virus induced gene silencing(VIGS)system.The fragment corresponding to nucleotides 156-523of StPRp27was PCR ampli?ed using primers XL9/XL10(Table1),and inserted into the Bam HI and Asp7181digested TRV(tobacco rattle virus)vector[26]. The resulted construct was subsequently transferred into A.tumefaciens strain GV3101by electroporation transfor-mation.Four-week-old plants of homozygote transgenic N.benthamiana lines RGC2-3-1and211-C12-13-6,which expressed Rpi-blb1and Rpi-blb2[27,28],respectively, were used in the VIGS experiments following the method described previously[26].

Rpi-blb1and Rpi-blb2confer resistance to P.infestans isolate PY23[29].All plant material was separately sub-jected to the silencing of the StPRp27homologous genes, the corresponding R-gene(positive control),and the phy-toene desaturase(PDS)gene.Plants applied by TRV empty vector was used as negative control.After silencing, N.benthamiana plants were tested for their response to P.infestans by using detached leaf assay.Five days after challenged with P.infestans,the detached leaves were evaluated for the development of disease symptoms. Leaves that showed hyphal growth of P.infestans were scored as susceptible,whereas leaves displaying no visible symptoms or clear hypersensitive response at inoculation sites were considered resistant.

RNA isolation and real time quantitative PCR

(qRT-PCR)analysis

The expression pattern of StPRp27was monitored in the course of the P.infestans inoculation.Total RNA was extracted using Trizol solution and reverse transcription was synthesised according to the manufacturer’s instruc-tions(Invitrogen).The Real time quantitative PCR(qRT-PCR)was performed on an Applied Biosystems7500Real Time PCR System using the SYBRòGreen Realtime PCR kit(TOYOBO)according to the manufacturer’s protocol. For qRT-PCR,primers XL7/XL8(Table1)were used to amplify the StPRp27gene,and primers XL37/XL38 (Table1)were used to amplify the internal constitutive control elongation factor1a(ef1a)gene(AB061263)in potato[30].Primers XL45and XL46(Table1)were designed based on the N.benthamiana sequence EST746786(GenBank accession number)that shows87% homology to StPRp27,and they were used to amplify the analogs of StPRp27in N.benthamiana.Primers XL49and XL50(Table1)were used to amplify the constitutive ef1a gene(GenBank accession number AY206004)in N.benthamiana.In preliminary experiment,the ampli?-cation ef?ciencies of the target and reference genes were approximately equal.Relative quanti?cation of gene expression levels were calculated using a comparative Ct method as described by Cˇikosˇet al.[31].

Mol Biol Rep

Results

Transient expression of StPRp27in N.benthamiana leaves slowed down the disease development

To determine whether StPRp27confers resistance to P.infestan s,plants of N.benthamiana which are suscep-tible to P.infestans isolates PY23and99189were used for transient expression of the StPRp27gene.The plants with transient expression of dominant gene Rpi-R3a(resistant gene to P.infestans isolate99189)or Rpi-sto(resistant gene to P.infestans isolate PY23)served as positive con-trols and the plants with transient expression of non-func-tional R gene abpt(susceptible to isolates99189and PY23) were employed as negative control.Two days after the agroin?ltration for transient expression of individual genes, leaves were detached and inoculated with P.infestans isolate99189and PY23,respectively.During the interac-tion period,the expression pattern of the StPRp27gene was monitored by qRT-PCR and a signi?cant expression of StPRp27was detected in StPRp27in?ltrated leaves(sup-plement Fig.S1)indicating a high ef?ciency of the tran-sient expression.Six days after inoculation,the leaves transiently expressed Rpi-R3a showed a clear resistant response to isolate99189at inoculation sites,whereas non-in?ltrated control leaves showed water-soaking symptoms covered with heavy oomycete hyphae(Fig.1a).It was obvious that StPRp27expressed leaves inhibited disease development represented by smaller lesion size compared to the negative control with expression of the non-func-tional R gene abpt(Fig.1a,b).

Similar results were obtained when leaves were inocu-lated with P.infestans isolate https://www.360docs.net/doc/741235107.html,pared to the negative control,a remarkable reduction of lesion size was observed in StPRp27expressed leaves(Fig.1a,c).These results suggested that expression of StPRp27may elevate plant resistance to different P.infestans isolates.

Over-expression of StPRp27in potato enhanced

the disease resistance

To elucidate whether StPRp27has function in potato resistance against different races of P.infestans,the StPRp27gene was over-expressed in potato cultivar E3by the Agrobacterium-mediated transformation.The results showed that more than20transgenic lines were obtained with one to three insertions,indicating that StPRp27over-expression cassette was integrated into the potato genome (supplement Fig.S2).The qRT-PCR analysis showed that the transcripts of StPRp27was increased from1to10fold in over-expressed lines with a relative high level of expression found in lines B2,B3and B9which were hence selected for further analysis.

The transgenic lines showed no signi?cant difference in overall plant phenotype compared with non-transformed control when they were grown in the greenhouse.Lea?ets of two-month-old transgenic and control plants were inoculated with an aggressive race mixture of P.infestans containing eight different virulence genes.To monitor accumulation of StPRp27transcripts,StPRp27gene expression patterns at0, 24,48,and72h after inoculation were examined using the qRT-PCR analysis(Fig.2a).Over-expression of StPRp27 resulted in a remarkable accumulation of the transcripts which was much higher than control at each time point.

Development of disease symptoms on inoculated leaves were illustrated by the mean value of the lesion growth rate (LGR).Signi?cant lower LGRs were obtained from StPRp27over-expressed plants compared with control (Fig.2b),indicating that over expression of StPRp27 enhanced resistance to the mixed races of P.infestans, which reinforced the?nding above that transient expres-sion in N.benthamiana,slowed down the blight develop-ment caused by two distinct isolates of P.infestans. Silencing homologous genes of StPRp27

in N.benthamiana did not affect R gene(Rpi-blb1

and Rpi-blb2)mediated resistance

To test whether the StPRp27gene is associated with the resistance mediated by dominant R gene,homologous genes of StPRp27in N.benthamiana transformed with Rpi-blb1or Rpi-blb2gene were silenced using the TRV induced gene silence approach.Silencing respective R gene in each corresponding transgenic plants and non-silencing plants were used for the comparison.Twenty days after gene silencing,TRV-PDS leaves(TRV-mediated phytoene desaturase gene silence to yield bleaching leaves as a visualized indicator of the gene silence)exhibited a photo-bleached phenotype,showing adequate ef?ciency of the silencing system used(data not shown).The silencing ef?ciency of StPRp27homologous genes in the R-gene transgenic N.benthamiana plants were quantitatively monitored by qRT-PCR which showed signi?cant reduc-tion in transcripts of StPRp27homologous genes at full course up to72h of the pathogen inoculation(Fig.3). Upper leaves from silenced plants were then detached and inoculated with P.infestans isolate PY23.As shown in Fig.4,5days after inoculation,sporulating hyphae of P.infestans were formed on R-gene silenced leaves sug-gesting that function of the R gene was inhibited by the gene silencing.In contrast,the R-gene transgenic leaves without silencing or treated with the empty silencing vector showed hypersensitive response at inoculation sites,rep-resenting a typical phenomenon of the interaction between Rpi-blb gene and isolate PY23of P.infestans.Meanwhile, silence of homologous genes of StPRp27in either of the

Mol Biol Rep

two R -gene transgenic N.benthamiana leaves also dis-played a hypersensitive response,suggesting exclusion of StPRp27homologous in this R -gene mediated resistance.

Discussion

Many studies have demonstrated that plant constitutively expressing pathogenesis-related proteins increases resis-tance against various pathogens.Among them,PR-1,PR-2,and PR-5proteins were reported to have inhibitory activity against P.infestans [12,32];Transient expression in wheat of PR-17gene,WCI-5,exhibited enhanced resistance to wheat powdery mildew fungus [33];A hypothetical pro-tein,pBH6-12having sequence similarity to WCI-5and NtPRp27was detected in guttation ?uid and supposed to protect barley leaves against motile bacteria in the vicinity of the hydathodes [34];and proteins of PR-17family were

also found in Citrus reticulata leaves challenged by Xylella fastidiosa [35]and in Capsicum chinense L 3plants induced by compatible or incompatible viral strains of pepper mild mottle virus [36],suggesting PR-17proteins might be involved in defense response to diverse pathogens in different plant species.Our results reported a new potato PR-17gene,StPRp27,its over-expression elevates resis-tance to P.infestans (Figs.1,2).This ?nding recon?rms our previous hypothesis that StPRp27might be involved in resistance against P.infestans in potato since it was rapidly induced in potato leaves by the pathogen [16].

A negative correlation could be established between expression of StPRp27and the lesion growth rate of the blight,i.e.,the higher the gene expression,the slower the disease development (Fig.2).This observation suggests that transcriptional regulation of StPRp27may be critical to restrain P.infestans infection.Similar results were also reported for other PR-genes,such as PR-1,PR-2,and

PR-5

Fig.1Nicotiana benthamiana leaves transiently expressed StPRp27exhibited enhanced resistance to P.infestans .

StPRp27,Rpi-R3a,Rpi-sto and abpt represent the leaves transient expression of the StPRp27,Rpi -R3a ,Rpi -sto and the non-functional R gene abpt using Agro-in?ltration method,respectively.CK means the non-in?ltrated leaves.a Symptoms of N.benthamiana leaves transiently expressed the

indicated genes.Two days after in?ltration with A.tumefaciens containing the expression

vectors,leaves were excised and inoculated with P.infestans isolate 99189or PY23.Pictures were taken 6days after the inoculation.b Percentage of the lesion area of the leaves inoculated with P.infestans isolate 99189.c Percentage of the lesion area of the leaves inoculated with P.infestans isolates PY23.Disease

development was scored as the percent of foliage infected at 8day post inoculation.Error bars represent the standard error of the mean of three independent replicates.**Indicates signi?cant

difference (P \0.01)compared with negative control that expressed abpt gene

Mol Biol Rep

were found to express at their highest level in resistant,intermediate in partially resistant and the lowest in sus-ceptible potato cultivars to P.infestans [37].If this potential relationship re?ects involvement of StPRp27,or other PR-genes,in the quantitative resistance is of both theoretical and applied importance to elucidate.

Similar results were obtained in present research that over-expression of StPRp27in both N.benthamiana and potato increased plant resistance to either two isolates or the race mixture containing eight virulence races of P.infestans (Figs.1,2),indicating that StPRp27confers a broad-spec-trum resistance to P.infestans .This conclusion is also re?ected by the resistance patterns of decreasing the lesion growth rate of the disease,which is a typical performance of the quantitative resistance [19,38].Similarly,There was a report of silencing NbPRp27in N.benthamiana which reduced basal resistance to Pseudomonas syringae pv .tabaci [15],suggesting PRp27gene alters the resistance through

its

Fig.2StPRp27expression and the lesion growth rate of the transgenic potato lines challenged by P.infestans .CK:control plant;B2,B3,and B9:the over expression transformants.a Expression pattern of StPRp27gene in control and StPRp27transgenic plants after inoculation using a mixture of P.infestans races.The inoculated leaves were harvested at 0,24,48,and 72h post inoculation.The relative quanti?cation of StPRp27expression is shown.In each case,

values are the mean of three observations ±SD .b The disease lesion growth rate (LGR)after P.infestans inoculation was calculated to compare the resistance levels between transgenic lines and control plants.The experiment was repeated three times and the bar represent the standard error of mean.*and **Indicates signi?cance at P \0.05and P \0.01,respectively,compared to untransformed control

(CK)

Mol Biol Rep

impact on the basal defense response of the host plants.The authors also observed that silencing of NbPRp27did not affect resistance to Colletotrichum species [15],demon-strating speci?city of each PR-gene in disease resistance.Besides resistance to P.infestans ,functions of StPRp27in respect to other pathogens is worth further investigation.It is noticeable that silencing StPRp27homologous in N.benthamiana did not affect the hypersensitive response mediated by potato late blight resistance genes Rpi-blb1and Rpi-blb2(Fig.4).We speculate that StPRp27may trigger the resistance in a pathway differed from Rpi-blb genes.Our previous research showed that StPRp27was strongly induced by jasmonic acid (JA)suggesting its function could be activated under JA-mediated signal pathway [16].Further analysis looking into the network by which StPRp27plays a role could be necessary for understanding the distinctive mechanism of StPRp27in late blight resistance and for compensating the knowledge of PR-genes in regulatory avenue of a speci?c trait.

Acknowledgments Transient expression and VIGS experiment were performed at the Plant Breeding,WUR.Transgenic potatoes were generated and resistance evaluation was performed at Huazhong Agricultural University.We are grateful to Maarten Nijenhuis and Hendrik Rietman for useful discussion.This study was partially supported by the Training Program under the Asia Facility for China 2005Project (AF05CH01),the Natural Science Foundation of Hubei Province,and the National High Technology Project of China (2006AA10Z149).

References

1.Dangl JL,Jones JD (2001)Plant pathogens and integrated defence responses to infection.Nature 411:826–833

2.Bhaskar P,Raasch J,Kramer L,Neumann P,Wielgus S,Austin-Phillips S,Jiang J (2008)Sgt1,but not Rar1,is essential for the RB -mediated broad-spectrum resistance to potato late blight.BMC Plant Biol 8:8

3.Hammond-Kosack KE,Parker JE (2003)Deciphering plant-pathogen communication:fresh perspectives for molecular resistance breeding.Curr Opin Biotechnol 14:177–193

4.Jorunn IBB,Thirumala-Devi K,Carolyn Y,Cahid C,Edgar H,Joe W,Miles RA,Paul RJB,Sophien K (2006)The C-terminal half of Phytophthora infestans RXLR effector AVR3a is suf?-cient to trigger R3a-mediated hypersensitivity and suppress INF1-induced cell death in Nicotiana benthamiana .Plant J 48:165–176

5.Muskett P,Parker J (2003)Role of SGT1in the regulation of plant R gene signalling.Microbes Infect 5:969–976

6.Turkensteen LJ (1993)Durable resistance of potatoes against Phytophthora infestans .In:Jacobs Th,Parlevliet JE (eds)Dura-bility of disease resistance.Kluwer Academic Publishers,Dordrecht,pp 115–124

7.Bormann CA,Rickert AM,Ruiz RAC,Paal J,Lubeck J,Strah-wald J,Buhr K,Gebhardt C (2004)Tagging quantitative trait loci for maturity-corrected late blight resistance in tetraploid potato with PCR-based candidate gene markers.Mol Plant Microbe Interact 17:1126–1138

8.Ewing EE,Simko I,Smart CD,Bonierbale MW,Mizubuti ESG,May GD,Fry WE (2000)Genetic mapping from ?eld tests of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii .Mol Breed 6:25–36

9.Simko I,Costanzo S,Ramanjulu V,Christ BJ,Haynes KG (2006)Mapping polygenes for tuber resistance to late blight in a diploid Solanum phureja 9S.stenotomum hybrid population.Plant Breed 125:385–389

10.Wang B,Liu J,Tian Z,Song B,Xie C (2005)Monitoring the

expression patterns of potato genes associated with quantitative resistance to late blight during Phytophthora infestans infection using cDNA microarrays.Plant Sci 169:1155–1167

11.Tian Z,Liu J,Wang B,Xie C (2006)Screening and expression

analysis of Phytophthora infestans induced genes in potato leaves with horizontal resistance.Plant Cell Rep

25:1094–1103

Fig.4Symptoms of detached N.benthamiana leaves,on which corresponding genes were silenced,were inoculated by the P.infestans isolate PY23.The transgenic N.benthamiana plants containing Rpi -blb1(a–d )and Rpi -blb2(e–h )were treated respec-tively with the TRV-gene silencing vectors.a and e non in?ltrated control;b and f in?ltrated with TRV empty vector;c and g silenced with corresponding R -gene,d and h StPRp27homologous gene were silenced.Twenty days after VIGS treatment,detached leaves were challenged by drop inoculation with P.infestans sporangia solutions of strain PY23and pictures were taken 5days after the inoculation

Mol Biol Rep

12.van Loon LC,Rep M,Pieterse CMJ(2006)Signi?cance of

inducible defense-related proteins in infected plants.Annu Rev Phytopathol44:135–162

13.Ferreira R,Monteiro S,Freitas R,Santos C,Chen Z,Batista L,

Duarte J,Borges A,Teixeira A(2007)The role of plant defence proteins in fungal pathogenesis.Mol Plant Pathol8:677–700 14.Okushima Y,Koizumi N,Kusano T,Sano H(2000)Secreted

proteins of tobacco cultured BY2cells:identi?cation of a new member of pathogenesis-related proteins.Plant Mol Biol 42:479–488

15.Xie W,Goodwin PH(2009)A PRp27gene of Nicotiana benth-

amiana contributes to resistance to Pseudomonas syringae pv.

tabaci but not to Colletotrichum destructivum or Colletotrichum orbiculare.Funct Plant Biol36:351–361

16.Tian Z,Liu J,Xie C(2003)Cloning of a pathogenesis-related

protein gene cDNA of potato using RACE methods combined with cDNA library.Acta Genet Sin30:996–1002

17.Champouret N,Bouwmeester K,Rietman H,van der Lee T,

Maliepaard C,Heupink A,van de Vondervoort PJ,Jacobsen E, Visser RG,van der Vossen EA,Govers F,Vleeshouwers VG (2009)Phytophthora infestans isolates lacking class I ipiO vari-ants are virulent on Rpi-blb1potato.Mol Plant Microbe Interact 22:1535–1545

18.Kamoun S,van West P,Vleeshouwers V,de Groot K,Govers F

(1998)Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INF1.Plant Cell10:1413–1425

19.Vleeshouwers VGAA,van Dooijeweert W,Paul Keizer LC,Si-

jpkes L,Govers F,Colon LT(1999)A laboratory assay for Phytophthora infestans resistance in various Solanum species re?ects the?eld situation.Eur J Plant Pathol105:241–250 20.Karimi M,Inze D,Depicker A(2002)Gateway vectors for

Agrobacterium-mediated plant transformation.Trends Plant Sci 7:193–195

21.Hamilton CM,Frary A,Lewis C,Tanksley SD(1996)Stable

transfer of intact high molecular weight DNA into plant chro-mosomes.Proc Natl Acad Sci93:9975–9979

22.Vleeshouwers VGAA,Rietman H,Krenek P,Champouret N,

Young C,Oh S-K,Wang M,Bouwmeester K,Vosman B,Visser RGF,Jacobsen E,Govers F,Kamoun S,van der Vossen EAG (2008)Effector genomics accelerates discovery and functional pro?ling of potato disease resistance and Phytophthora infestans avirulence genes.PLoS ONE3:e2875

23.van der Hoorn RAL,Laurent F,Roth R,De Wit PJGM(2000)

Agroin?ltration is a versatile tool that facilitates comparative analyses of Avr9/Cf-9-induced and Avr4/Cf-4-induced necrosis.

Mol Plant Microbe Interact13:439–446

24.Si H,Xie C,Liu J(2003)An ef?cient protocol for Agrobacte-

rium-mediated transformation with micro tuber and the intro-duction of an antisense class I patatin gene into potato.Acta Bot Sin29:801–805

25.Tian Z,Liu J,Xie C,Song B(2003)Cloning of potato POTHR-1

gene and its expression in response to infection by Phytophthora infestans and other abiotic stimuli.Acta Bot Sin45:959–96526.Liu Y,Schiff M,Marathe R,Dinesh-Kumar SP(2002)Tobacco

Rar1,EDS1and NPR1/NIM1like genes are required for N-med-iated resistance to tobacco mosaic virus.Plant J30:415–429 27.van der Vossen EAG,Gros JE,Sikkema A,Muskens M,Wouters D,

Wolters P,Pereira A,Allefs S(2005)The Rpi-blb2gene from Solanum bulbocastanum is an Mi-1gene homolog conferring broad-spectrum late blight resistance in potato.Plant J44:208–222 28.van der Vossen EAG,Sikkema A,Hekkert BL,Gros J,Stevens P,

Muskens M,Wouters D,Pereira A,Stiekema W,Allefs S(2003) An ancient R gene from the wild potato species Solanum bulbo-castanum confers broad-spectrum resistance to Phytophthora in-festans in cultivated potato and tomato.Plant J36:867–882 29.Rietman H(2006)Identi?cation of Rpi-blb1homologues in

Solanum species by functional pro?ling with ipiO effectors from Phytophthora infestans.MSc Thesis,Wageningen University, Wageningen

30.Nicot N,Hausman J-F,Hoffmann L,Evers D(2005)House-

keeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress.J Exp Bot56:2907–2914 31.CˇikosˇSˇ,Bukovska′A,Koppel J(2007)Relative quanti?cation of

mRNA:comparison of methods currently used for real-time PCR data analysis.BMC Mol Biol8:113

32.Niderman T,Genetet I,Bruye`re T,Gees R,Stintzi A,Legrand M,

Fritig B,Mosinger E(1995)Pathogenesis-related PR-1proteins are antifungal;isolation and characterization of three14-kilo-dalton proteins of tomato and of a basic PR-1of tobacco with inhibitory activity against Phytophthora infestans.Plant Physiol 108:17–27

33.Schweizer P,Pokorny J,Abderhalden O,Dudler R(1999)A

transient assay system for the functional assessment of defense-related genes in wheat.Mol Plant Microbe Interact12:647–654 34.Grunwald I,Rupprecht I,Schuster G,Kloppstech K(2003)

Identi?cation of guttation?uid proteins:the presence of patho-genesis-related proteins in non-infected barley plants.Physiol Plant119:192–202

35.Campos MA,Rosa DD,Teixeira JE′C,Targon MLPN,Souza AA,

Paiva LV,Stach-Machado DR,Machado MA(2007)PR gene families of citrus:their organ speci?c-biotic and abiotic inducible expression pro?les based on ESTs approach.Genet Mol Biol 30:917–930

36.Elvira MI,Galdeano MM,Gilardi P,Garcia-Luque I,Serra MT

(2008)Proteomic analysis of pathogenesis-related proteins(PRs) induced by compatible and incompatible interactions of pepper mild mottle virus(PMMoV)in Capsicum chinense L-3plants.

J Exp Bot59:1253–1265

37.Vleeshouwers VGAA,van Dooijeweert W,Govers F,Kamoun S,

Colon LT(2000)Does basal PR gene expression in Solanum species contribute to non-speci?c resistance to Phytophthora infestans?Physiol Mol Plant Pathol57:35–42

38.Mihovilovich E,Munive S,Bonierbale M(2010)In?uence of

daylength and isolates of Phytophthora infestans on?eld resis-tance to late blight of potato.Theor Appl Genet120:1265–1278

Mol Biol Rep