DNA shuffling of methionine adenosyltransferase gene leads to improved S

Journal of Biotechnology 141(2009)97–103

Contents lists available at ScienceDirect

Journal of

Biotechnology

j o u r n a l h o m e p a g e :w w w.e l s e v i e r.c o m /l o c a t e /j b i o t e

c

DNA shuf?ing of methionine adenosyltransferase gene leads to improved S-adenosyl-l -methionine production in Pichia pastoris

Hui Hu,Jiangchao Qian ??,Ju Chu ?,Yong Wang,Yingping Zhuang,Siliang Zhang

State Key Laboratory of Bioreactor Engineering,National Engineering Research Center for Biotechnology (Shanghai),East China University of Science &Technology,130Meilong Road,Shanghai 200237,PR China

a r t i c l e i n f o Article history:

Received 22October 2008

Received in revised form 16February 2009Accepted 17March 2009Keywords:

S-adenosyl-l -methionine

Methionine adenosyltransferase DNA shuf?ing Pichia pastoris

a b s t r a c t

S-Adenosyl-l -methionine (SAM)is an important molecule for normal cell function and survival.To enhance methionine adenosyltransferase (MAT,EC2.5.1.6)activity and thus SAM production in recombi-nant Pichia pastori s,MAT genes from Escherichia coli ,Saccharmyces cerevisiae ,and Streptomyces spectabilis were recombined by DNA shuf?ing.The shuf?ed genes were transformed into P.pastoris GS115to con-struct recombinant strains and screened for high MAT activity and enhanced SAM production mutants.In the two best recombinant strains,the MAT activities were respectively 201%and 65%higher than the recombinant strains containing the starting MAT genes,and the SAM concentration increased by 103%and 65%respectively.The analysis on the deduced sequences of ?ve representative MAT variants showed that the K18R mutation probably resulted in the increased activity of the best MAT,which may provide new insights into structure-enzyme activity relationship of MAT and might shed light on the further rational evolution of MAT.Finally,a 6.14g l ?1of SAM production was reached in a 500l bioreactor with the best recombinant strain GS115/DS56,which showed a favorable foreground in industrial scale production of SAM.

?2009Elsevier B.V.All rights reserved.

1.Introduction

S-Adenosyl-l -methionine (SAM)is the major intracellular methyl donor in all living organisms (Park et al.,1996).In addition to acting as a methyl donor,SAM also plays an important role in transsulfuration and polyamine synthesis reactions.Considerable interest in SAM production has arisen because it can treat affec-tive disorders,liver disease,and neurological effectively (Lu,2000).Therefore,several strains have been screened successively to pro-duce SAM,such as yeast (Shiozaki et al.,1986;Shobayashi et al.,2005)and Kluyveromyces lactis (Mincheva and Balutsov,2002).

Methionine adenosyltransferase (MAT,EC2.5.1.6)is the only known enzyme to synthesize SAM in organisms.It catalyzes ATP and l -methionine (l -Met)to synthesize SAM.The recombinant Pichia pastoris (Li et al.,2002;Yu et al.,2003)and Escherichia coli (Mato et al.,1995;Yang et al.,2002)that over-expressed MAT were constructed for SAM production.A positive correlation was

Abbreviations:ATP,adenosine triphosphate;DO,dissolved oxygen;DCW,dry cell weight;l -Met,l -methionine;MAT,methionine adenosyltransferase;rpm,rota-tion per minute;SAM,S-adenosyl-l -methionine;VVM,volume of gas per volume of liquid per minute.

?Corresponding author.Tel.:+8602164253021;fax:+8602164253702.??Corresponding author.Tel.:+8602164250736;fax:+8602164253702.

E-mail addresses:jiangchaoqian@https://www.360docs.net/doc/7f19250773.html, (J.Qian),juchu@https://www.360docs.net/doc/7f19250773.html, (J.Chu).

revealed between SAM accumulation and MAT activity.Therefore,it is of great importance to enhance MAT activity for SAM accumu-lation.

Increasing MAT expression level is a routine method to enhance the enzyme activity.However,SAM,but not MAT,is the desired product of the bioprocess.Over-expression of MAT gene also might inhibit cell growth and SAM production due to the competition of resource and energy.Therefore,molecular evolution of MAT to increase its speci?c enzyme activity is a better way to enhance MAT activity for SAM accumulation.DNA is widely used for in vitro molecular evolution (Crameri et al.,1998).It involves the recombi-nation of multiple homologous DNA sequences to create a hybrid gene library for selection.This method has been shown to be a pow-erful engineering approach to tailor the properties of enzymes,such as thermostability (Suen et al.,2004;Emond et al.,2008),activity (Tatsuya and Yoshinori,2007;Ryu et al.,2008),and pH stability (Liu et al.,2005)of the enzymes.

The methylotrophic yeast P.pastoris has been developed into a commercially important host for the production of heterologous proteins because it has the unique ability to grow on minimal media at very high cell densities with the strong,tightly regulated alco-hol oxidase promoter (Cereghino and Cregg,2000).Furthermore,excess SAM in yeast is sequestered in the vacuole,so yeast itself can accumulate high level of SAM (Chan and Appling,2003;Megumi et al.,2007).Combined with these advantages,the recombinant P.pastoris has the potential to accumulate higher level of SAM.

0168-1656/$–see front matter ?2009Elsevier B.V.All rights reserved.doi:10.1016/j.jbiotec.2009.03.006

98H.Hu et al./Journal of Biotechnology141(2009)97–103

In this study,three homologous MAT genes from Saccharmyces cerevisiae,E.coli DH5?and Streptomyces spectabilis(GenBank acces-sion nos.M23368,AE000377,and AF117274),which share52–62% nucleic acid identity,were shuf?ed to generate a hybrid MAT gene library.The shuf?ed MAT genes were then transformed into P. pastoris GS115to enhance SAM production.The highest MAT activ-ity and SAM concentration of463U g?1DCW and1.64g l?1were achieved in the best strain(GS115/DS56)in shake?ask cultiva-tion,which had201%and102%improvement respectively over the recombinant strain harboring MAT gene from S.cerevisiae.The sequence alignment,conservation analysis,and tertiary structure construction were performed to speculate the mechanism of the altered activities of?ve selected shuf?ed MATs.Finally,the maxi-mum SAM concentration in GS115/DS56reached6.14g l?1in a500l bioreactor,which showed a favorable foreground in commercial production of SAM.

2.Materials and methods

2.1.General methods

E.coli DH5?was used for routine subcloning employing stan-dard growth media and conditions(Sambrook and Russell,2001). Plasmid pPIC3.5K was used for constructing MAT gene expression vector in P.pastoris GS115,and the transformation of DNA into P.pas-toris GS115was performed as described by the instruction manual of Pichia expression kit(Invitrogen BV,Groningen,The Nether-lands).The kits for plasmid isolation,restriction enzyme digestion, DNA ligation,DNA puri?cation,and isolation of the genomic DNA of E.coli DH5?and S.cerevisiae were purchased from TaKara Co. (Takara,Tokyo,Japan).Shuf?ed MAT genes were sequenced at TaKara Corporation(Takara,Tokyo,Japan).

2.2.Culture condition

The MD plate was used to screen His+recombinant P.pas-toris strains,and the YPD-Geneticin plate was used to estimate the copy number of MAT gene integrated into the chromosome of recombinant P.pastoris strain as described by the manual of Pichia Expression Kit(Invitrogen BV,Groningen,The Netherlands).

The cultivation of recombinant P.pastoris strains in250ml shake ?asks or15ml tubes for SAM production was similar to those described previously(Chen et al.,2007),with some modi?cations in the induction phase.During the induction phase,the concentra-tions of methanol were measured and100%methanol was added to a?nal concentration of1.2%(v/v)every12h,and the sterile l-Met(Bafeng,China)powder was added every24h to a?nal con-centration of0.1%(w/v)12h after induction to initiate the SAM synthesis.

For5l bioreactor(FUS,Guoqiang,China)cultivation,the initial batch phase procedure was carried out according to the method described previously(Hu et al.,2007).After the batch phase,the sterile50%(v/v)glycerol solution with1.2%(v/v)PTM1trace salts solution(Invitrogen BV,Groningen,The Netherlands)was fed for about16h with a constant rate of20.2g l?1h?1.Then,the strain was induced by100%methanol,fed together with1.2%(v/v)PTM1 trace salts solution with a constant rate of6.8g l?1h?1.The sterile l-Met powder(total15g l?1culture broth)was supplemented for three times,at a concentration of5g l?1every20h from12to52h of induction(Hu et al.,2007).

The cultivation in a500l bioreactor(B.Braun,Genmany)was similar to that in a5l bioreactor,but the feeding rate of50%glycerol (with1.2%(v/v)PTM1trace salts solution)and methanol(with1.2% (v/v)PTM1trace salts solution)was23.8and7.5g l?1h?1,respec-tively.Table1

Primers used for ampli?cation of homologous MAT genes.

Source Primers(5 –3 )a

E.coli DH5?,CCAGAATTCATGGCAAAACACCTTTTTACGTC

(forward primer)

TATGCGGCCGCTTACTTCAGACCGGCAGCATC

(Reverse Primer)

S.cerevisiae CCAGAATTCATGTCCAAGAGCAAAACTTTC

(forward primer)

TAAGCGGCCGCTTAAAATTCCAATTTCTTTG

(Reverse Primer)

S.spectabilis CCAGAATTCGTGTCCCGCCGTCTCTTCACCTCG

(forward primer)

TATGCGGCCGCTCAGTGAACAAGCGGCAGGAG

(Reverse Primer)

a Sequences added to introduce restriction endonuclease recognition sites(Eco RI and Not I)are underlined.

2.3.Plasmid and strain construction

The MAT genes from S.cerevisiae and E.coli DH5?were ampli-?ed from their genomic DNA,respectively.The MAT gene from S. spectabilis was ampli?ed from plasmid pWHM3-SAM(Chen et al., 2007).Primers used are listed in Table1.

All MAT genes were inserted into the Eco RI-Not I sites of pPIC3.5K to construct pPIC3.5K/EC,pPIC3.5K/SA,and pPIC3.5K/ST,respec-tively.Plasmid constructions were con?rmed by restriction enzyme digestion and DNA sequence analysis.The recombinant plasmids were linearized by Bgl II and transformed into P.pastoris GS115 and selected on MD plates.Positive clones were cultured on YPD-Geneticin plate.The resultant strains which could only grow on YPD-Geneticin plate containing0.25mg ml?1Geneticin(could not grow on YPD-Geneticin plate containing0.5mg ml?1Geneticin or higher)were selected and denoted as GS115/SA,GS115/EC,and GS115/ST,respectively.The plasmid pPIC3.5K was also linearized by Bgl II and transformed into P.pastoris GS115to generate a control strain(denoted as GS115/3.5K).

2.4.DNA shuf?ing

Three～1.4kb DNA fragments containing the MAT genes from pPIC3.5K/EC,pPIC3.5K/SA,and pPIC3.5K/ST were ampli?ed by using5 AOX1(5 -GACTGGTTCCAATTGACAAGC-3 )and3 AOX1(5 -GCAAATGGCATTCTGACATCC-3 )primers.Equal amounts of three MAT gene preparations were mixed,and digested with DNase I,then subjected to shuf?ing procedure as described previously(Zhao and Frances,1997)with minor modi?cations.The program of primerless PCR was changed as following:one cycle at94?C for3min,followed by50cycles at94?C for60s,30?C for60s,72?C for90s and one cycle at72?C for7min.The primerless PCR product was ampli-?ed by using5 AOX1and3 https://www.360docs.net/doc/7f19250773.html, Taq DNA polymerase (Takara,Tokyo,Japan)was used for all PCRs.The resulting MAT gene libraries were inserted into the Eco RI-Not I sites of pPIC3.5K and transformed into E.coli DH5?to maintain and propagate the shuf?ed libraries.Recombinant E.coli DH5?colonies(～104)were combined,and recombinant plasmids were extracted and puri?ed. The puri?ed recombinant plasmids were linearized by Bgl II diges-tion and transformed into P.pastoris GS115for screening.

2.5.Screening procedures

Recombinant strains harboring shuf?ed MAT genes were cul-tured in15ml tube and the intracellular SAM concentration was assayed after cultivation.Strains with improved SAM production were con?rmed by cultivation in250ml shake?asks.Recombinant strains harboring wild-type MAT genes were used as the control.

H.Hu et al./Journal of Biotechnology 141(2009)97–103

99

https://www.360docs.net/doc/7f19250773.html,parison of MAT activity (a),SAM concentration (b),and DCW (c)in GS115/3.5K (1)GS115/SA (2),GS115/EC (3),and GS115/ST (4).All strains were induced with methanol for 96h in shake ?ask cultivations.Data are means ±SE of three replicates.

2.6.Analytical methods

To determine the dry cell weight (DCW),cells were harvested by centrifugation at 12,000rpm for 5min,washed twice with deionized water,and dried to a constant weight at 80?C.SAM con-centration was assayed as described by Wanger et al.(1984)and MAT activity was assayed according to the method reported by Shiozaki et al.(1984).One unit (U)of enzyme was de?ned as that required to catalyze the transformation of 1?mol l -Met into SAM per hour at 37?C.

2.7.Conservation analysis and tertiary structure construction of MAT

The conservative sites of MAT were analyzed by NCBI Conserved Domains Search (https://www.360docs.net/doc/7f19250773.html,/Structure/cdd/wrpsb.cgi ).The tertiary structures of the shuf?ed and wild-type MAT were constructed using the Swiss-model server (https://www.360docs.net/doc/7f19250773.html,/SWISS-MODEL.html ).Reported structures of MAT from E.coli (pdb code:1xra)(Takusagawa et al.,1996)or human (pdb code:2p02,Structural Genomics Consortium,doi:10.2210/pdb2p02/pdb )were used as construction templates.The selection of template depended on the homology degree between the target and the modeled MAT.The putative active sites of the shuf?ed and wild-type MAT were deduced from the reported structure of MAT from E.coli (Takusagawa et al.,1996;John and George,1999)through DNA alignment.3.Results

3.1.Expression of exogenous MAT genes in P.pastoris

Three recombinant strains (GS115/SA,GS115/EC,and GS115/ST)harboring the wild-type MAT genes from S.cerevisiae ,E.coli ,and

S.

Fig.2.Relative SAM concentration in the recombinant strains harboring shuf?ed MAT gene.All strains were induced with methanol for 60h in tube cultivations.Recombinant strains harboring the wild-type MAT genes were used as the control and SAM concentration in GS115/SA was de?ned as 1.

spectabilis were cultured in the shake ?asks and strain GS115/3.5K was used as the control.After induced with methanol for 96h,MAT activity and SAM concentration were much higher in GS115/SA,GS115/EC,and GS115/ST than that in GS115/3.5K.MAT activity and SAM concentration in the best recombinant strain (GS115/SA)were 153.68±19.87U g ?1DCW and 0.81±0.11g l ?1,respectively,which were about 21times and 134times higher than those in GS115/3.5K,respectively.It could be concluded that high MAT activ-ity and improved SAM production were obtained in recombinant strains expressing exogenous MAT genes (Fig.1a and b).There was no obvious difference in the cell mass among the four strains,which indicated that MAT expression and SAM production did not markedly affect cell growth (Fig.1

c).

https://www.360docs.net/doc/7f19250773.html,parison of MAT activity (a),SAM concentration (b),and DCW (c)in GS115/SA (1)GS115/DS16(2),GS115/DS56(3),GS115/DS34(4),GS115/DS69(5),and GS115/DS4(6).All strains were induced with methanol for 96h in shake ?ask cultivations.Data are means ±SE of three replicates.

100H.Hu et al./Journal of Biotechnology 141(2009)

97–103

Fig.4.The tertiary structures of the shuf?ed and wild-type MAT constructed by Swiss-model server.The tertiary structures of pST (residues 2–392)(a),pDS56(residues 2–403)(b),and pDS4(residues 2–392)(c)were constructed by Swiss-model server using the structure of MAT from E.coli as a template.The tertiary structures of pSA (residues 6–384)(d),pDS16(residues 7–384)(e),and pDS69(residues 6–384)(f)were constructed by Swiss-model server using the structure of MAT from human as a template.Arrows indicated the different structure between pDS16and pSA.The putative active sites of MAT are shown in green and the mutations are shown in red (for interpretation of the references to color in this ?gure legend,the reader is referred to the web version of the article).

3.2.Screening of MAT gene variants obtained by DNA shuf?ing To obtain MAT with higher speci?c activity,MAT genes from S.cerevisiae ,E.coli ,and S.spectabilis (52–62%nucleic acid identity)were recombined by DNA shuf?ing.The Libraries of shuf?ed MAT genes were inserted into pPIC3.5K at the Eco RI-Not I sites and trans-formed into P.pastoris GS115to construct the recombinant strains for screening.Approximately 400clones were screened for produc-tion of SAM.The SAM concentration in GS115/SA was de?ned as 1,relative SAM concentration in GS115/EC and GS115/ST were 0.71and 0.58,respectively.Among the 412clones screened,13clones (3.2%)produced a relatively higher SAM concentration above 1,188clones (45.6%)produced a comparable SAM concentration between 0.58and 1,and 211clones (51.2%)produced a relative lower SAM concentration less than 0.58(Fig.2).

Among the 412clones tested,the two best (GS115/DS16and GS115/DS56)and three negative clones (GS115/DS4,GS115/DS34,and GS115/DS69)were picked for further study.All ?ve strains

H.Hu et al./Journal of Biotechnology141(2009)97–103101

were cultured in shake?asks.At the end of cultivation,MAT activ-ity and SAM concentration in GS115/DS56and GS115/DS16were signi?cantly higher than in GS115/SA(Fig.3a and b),which sug-gested that these two strains harbored the improved MAT genes that enhanced the SAM production.MAT activity and SAM con-centration in the best strain GS115/DS56were463.34±24.68U g?1 DCW and1.64±0.14g l?1,respectively,which were2.01and1.02 times higher than that of strain GS115/SA,respectively.The three negative strains were poor in MAT expression and SAM production (Fig.3a and b),which suggested that these three strains harbored the negative MAT genes generated by DNA Shuf?ing.The cell mass of the two best and three negative clones were nearly the same (Fig.3c),which agreed with the result shown in Fig.1c.

3.3.Sequence analysis of the MAT gene variants

The shuf?ed MAT genes integrated in the chromosome of the?ve selected strains were sequenced.The amino acid sequences of the shuf?ed MAT(denoted as pDS16,pDS56,pDS4,pDS34,and pDS69, respectively)were deduced from their DNA sequences.

The amino acid sequences of pDS16,pDS69and pDS34had99%, 98%and97%identity with MAT from S.cerevisiae(denoted as pSA), https://www.360docs.net/doc/7f19250773.html,pared with pSA,two site mutations(K5E and I337V)appeared in pDS16and four site mutations(C23A,A48D, D155G,and K278G)appeared in pDS69.A stop codon appeared in the DNA sequence of pDS34,which would lead to the incom-plete translation of pDS34with only117amino acid residues.This stop codon resulted in the nearly complete inactivation of pDS34 and thus almost no accumulation of SAM in GS115/DS34.Therefore, pDS34would not be discussed further.

The amino acid sequences of pDS4and pDS56had99%and98% identity with MAT from S.spectabilis(denoted as pST),respectively. Compared with pST,four site mutations(K18R,L31P,I65V,and D341G)appeared in pDS56and three site mutations appeared in pDS4(K187E,S281F,and R398D).There was also a frame shift muta-tion(395th–404th)in the DNA sequence of pDS56,which would lead to a truncated MAT with404amino acid residues.

To further analyze the structure-enzyme activity relationship of MAT,tertiary structures of the shuf?ed and wild-type MAT were constructed using Swiss-model server.The results showed that mutations,which appeared in all the selected MAT variants except pDS16(Fig.4e),did not affect the tertiary structure(Fig.4b,c,and f).Meanwhile,the conservative sites of MAT were also analyzed (Table2).

The K18R substitution is the only mutation in the conservative sites in pDS56(Table2).The tertiary structure of pDS56also showed that only the K18R mutation was near the putative active sites of the enzyme(Fig.4b).These results suggested that the K18R mutation probably resulted in the increased activity of pDS56.The tertiary structure of pDS16was changed,but the I337V mutation in pDS16 was away from the putative active sites of MAT(Fig.4e).The con-Table2

The conservative analysis of the mutations appeared in pDS4,pDS16,pDS56,and pDS69.

Proteins Mutations/conservation a

pDS165th/N337th/N

pDS6923rd/N48th/N155th/N278th/Y

pDS5618th/Y31st/N65th/N341st/N395th–404th/N pDS4187th/N281st/Y398th/N

a Y represents conservative and N represents not conservative.

servative analysis of mutations in pDS16also indicated that the two mutations were nonconservative(Table2).So the mechanism of the improved activity of pDS16was still enigmatic.

The conservative analysis of mutations(Table2)showed that there was only one conservative mutation in pDS4(S281F)and pDS69(K278G),respectively.The S281F mutation in pDS4was close to the putative active sites of the enzyme(Fig.4c)and the K278G mutation in pDS69was exactly at one of the putative active sites (Fig.4f).The C23A mutation in pDS69was also near the putative active sites of the enzyme(Fig.4f),but this site was not conserva-tive.And the same C23A mutation also happened in the wild-type MAT(Mautino et al.,1996).Other mutations in pDS4and pDS69 were all away from the putative active sites of MAT(Fig.4c and f). Therefore,the decreased activity of pDS4was probably due to the S281F mutation and the K278G mutation was likely to result in the inactivation of pDS4.

3.4.Production of SAM by strain GS115/DS56in5l and500l bioreactors

Strain GS115/DS56was cultured in a5l bioreactor.As shown in Fig.5a,the maximal MAT activity of587.2U g?1DCW was achieved in GS115/DS56after42h of induction,which was2.8times higher than that of GS115/SA.SAM concentration in GS115/DS56also increased markedly due to the improvement of MAT activity.The maximum SAM concentration in GS115/DS56reached5.59g l?1 after62h of methanol induction,which was about28%higher than that of GS115/SA(Fig.5b).Similar with the cultivation in shake ?asks(Fig.1c and Fig.3c),the cell mass of the four recombinant strains was not changed with the varied MAT activity and SAM production(Fig.5c).Finally,the cultivation scale was scaled up to 500l.The maximum SAM concentration of6.14g l?1was obtained in GS115/DS56,which showed a favorable foreground for industrial application.

4.Discussions

We succeeded in constructing a new recombinant

strain

(GS115/DS56)with increased MAT activity and SAM production in

both shake?asks and500l bioreactor by expressing an improved

https://www.360docs.net/doc/7f19250773.html,parison of MAT activity(a),SAM concentration(b),and DCW(c)in GS115/DS56(rectangle),GS115/SA(triangle),GS115/EC(pentagram),and GS115/ST(circle) cultured in a5l bioreactor.Arrows indicated the time for l-Met addition.

102H.Hu et al./Journal of Biotechnology141(2009)97–103

MAT gene.The increased MAT activity played a key role in the high SAM production.

There are two ways to increase the heterogenous enzyme activ-ity in the recombinant strains:one is to increase the expression level and the other is to improve the speci?c activity of the enzyme. However,increasing the expression level of heterogenous enzyme will consume more resource and energy,and even inhibit the cell growth.It was reported that full induction of styAB expression in E. coli JM101had led to a strong inhibition of cell growth and washout (Bruno et al.,2008).The similar effect was also observed in alkane monooxygenase-overproducing,E.coli(Favre-Bulle and Witholt, 1992).In this study,the desired product is not the enzyme itself (MAT),but the MAT-catalyzed product SAM.And ATP is another substrate in this MAT-catalyzed SAM biosynthesis reaction.Thus, the better way to increase MAT activity and SAM accumulation is to improve the speci?c activity of MAT.In this study,the enhanced activity of MAT variant should be attributed to the improved speci?c activity.Firstly,the MAT gene copy should be the same in all recom-binant strains harboring the shuf?ed or wild-type MAT genes.Since all the recombinant strains were cultured on the YPD-Geneticin plate and strains which could only grow on YPD-Geneticin plate containing0.25mg ml?1Geneticin but could not grow on YPD-Geneticin plate containing0.5mg ml?1Geneticin or higher were selected.This selection ensures that only one copy of the MAT gene should be integrated into the chromosome of the P.pastoris (Scorer et al.,1994).Secondly,the similar expression cassette(only several amino acid residue substitutions happened in the coding sequence of all the MAT gene variants)would lead to the similar MAT transcription level in each recombinant strain.Therefore,the varied MAT activities in the recombinant strains were mainly due to the different coding sequences of the MAT variants,and the high MAT activity in GS115/DS56should be attributed to the improved speci?c activity of pDS56encoded by the recombinant MAT gene obtained by DNA shuf?ing.

No crossovers happened in the?ve selected shuf?ed MAT genes, but we found a crossover appeared in another two sequenced MAT genes.It meant that the three homologous MAT genes were not completely shuf?ed.We supposed that the low nucleic acid identity between the three homologous MAT genes(52–62%)resulted in the uncompleted shuf?ing because the conserved nucleic acids among the three homologous MAT gene sequences were no more than10 bases long.To force crossover based on such short sequence iden-tity,a very low effective annealing temperature in the primerless PCR should be used(Stemmer,1994).Thus,the annealing tem-perature in the primerless PCR could be optimized in the further studies.

In our best recombinant strain GS115/DS56,the degree of increased MAT activity was much higher than that of SAM pro-duction.The MAT activity was83%higher in GS115/DS56than in GS115/DS16in the shake?ask cultivations,while the SAM concentration and speci?c SAM concentration(calculated by divid-ing the SAM concentration(g l?1)by the dry cell weight(g l?1)) only increased about22%and24%,respectively.This phenomenon also happened in the5l bioreactor https://www.360docs.net/doc/7f19250773.html,pared with GS115/SA,the maximum MAT activity in GS115/DS56had2.8times improvement,but the maximum SAM concentration and speci?c SAM concentration only increased about28%and13%,respectively. Therefore,MAT activity was not the only limiting factor for SAM production and too high MAT activity would not further increase SAM production signi?cantly.

It was demonstrated that alternate or mixed feeding of methanol and glycerol during the induction phase improved ATP synthesis and SAM production in the recombinant P.pastoris strain harbor-ing the MAT gene from S.cerevisiae although the MAT activity was decreased(Li et al.,2002;Hu et al.,2007).Furthermore,Virtreoscilla hemoglobin gene was transformed into the recombinant P.pastoris strain harboring the MAT gene from S.spectabilis to improve ATP synthesis and thus enhanced SAM production(Chen et al.,2007). Thus,it could be concluded that the ATP level was another limiting factor for SAM production.The l-Met feeding strategy also affected the SAM production.Liu et al.(2006)compared?ve different l-Met addition strategies and found that feeding l-Met continuously was the best strategy for SAM production.Therefore,further studies on the combined effects of MAT activity,ATP level,and l-Met feeding strategy should be carried out to optimize the SAM production.

Acknowledgements

We are grateful to National Basic Research Program(973 Program No.2007CB714306),the National High Technology Research and Development Program of China(863Program No.2007AA100601)and Science and Technology Commission of Shanghai Municipality(07pj14027)for their?nancial supports to this research.

References

Bruno,B.,Park,J.B.,Lars,M.B.,Schmid,A.,2008.NADH availability limits asymmetric biocatalytic epoxidation in a growing recombinant Escherichia coli strain.Appl.

Environ.Microbiol.74(5),1436–1446.

Cereghino,J.L.,Cregg,J.M.,2000.Heterologous protein expression in the methy-lotrophic yeast Pichia pastoris.FEMS Microbiol.Rev.24,45–66.

Chan,S.Y.,Appling,D.R.,2003.Regulation of S-adenosylmethionine levels in Saccha-romyces cerevisiae.J.Biol.Chem.278,43051–43059.

Chen,H.X.,Chu,J.,Zhang,S.L.,Zhuang,Y.P.,Qian,J.C.,Wang,Y.H.,Hu,X.Q.,2007.Intra-cellular expression of Vitreoscilla hemoglobin improves S-adenosylmethionine production in a recombinant Pichia pastoris.Appl.Microbiol.Biotechnol.74(6), 1205–1212.

Crameri,A.,Raillard,S.A.,Bermudez,E.,Stemmer,W.P.,1998.DNA shu?ing of a family of genes from diverse species accelerates directed evolution.Nature391(6664), 288–291.

Emond,S.,Andre,I.,Jaziri,K.,Potocki-Veronese,G.,Mondon,P.,Bouayadi,K.,Kharrat,

H.,Monsan,P.,Remaud-Simeon,M.,https://www.360docs.net/doc/7f19250773.html,binatorial engineering to enhance

thermostability of amylosucrase.Protein Sci.17,967–976.

Favre-Bulle,O.,Witholt, B.,1992.Biooxidation of n-octane by a recombinant Escherichia coli in a two-liquid-phase system:effect of medium components on cell growth and alkane oxidation activity.Enzyme Microb.Technol.14,931–937.

Hu,X.Q.,Chu,J.,Zhang,S.L.,Zhuang,Y.P.,Wang,Y.H.,Zhu,S.,Zhu,Z.G.,Yuan,Z.Y.,2007.

A novel feeding strategy during the production phase for enhancing the enzy-

matic synthesis of S-adenosyl-l-methionine by methylotrophic Pichia pastoris.

Enzyme Microb.Technol.40,669–674.

John,C.T.,George,D.M.,1999.The bifunctional active site of S-adenosylmethionine synthetase.J.Biol.Chem.274(46),32909–32914.

Li,D.Y.,Yu,J.,Tian,L.W.,Ji,X.S.,Yuan,Z.Y.,2002.Production of SAM by recombinant Pichia pastoris.Chin.J.Biotechnol.3,295–299.

Liu,P.Y.,Zhu,D.H.,Tan,T.W.,2006.Effect of feeding pre-l-methionine on high-cell-density fermentation for S-adenosyl-l-methionine production.Chin.J.

Biotechnol.22(2),268–272.

Liu,Z.Q.,Sun,Z.H.,Zheng,P.,Leng,Y.J.,Qian,S.,2005.Directed evolution of d-lactonohydrolase by error prone PCR and DNA shuf?ing.Sheng Wu Gong Cheng Xue Bao21(5),773–781.

Lu,S.C.,2000.S-adenosylmethionine.Int.J.Biochem.Cell Biol.32,391–395. Mato,J.M.,Pajares,M.A.,Mingorance,J.,Avarez,L.,1995.Production of S-adenosyl-methionine(SAM)by fermentation of transformed bacteria.European patent 0647712A1.

Mautino,M.R.,Barra,J.L.,Rosa,A.L.,1996.eth-1,the neurospora crassa locus encoding S-adenosylmethionine synthetase:molecular cloning,sequence analysis and in vivo overexpression.Genetics142(3),789–800.

Megumi,S.,Tsutomu, F.,Haruyuki,I.,2007.Effects of accumulated S-adenosylmethionine on growth of yeast cells.Biosci.Biotechnol.Biochem.71

(6),1595–1597.

Mincheva,K.P.,Balutsov,V.M.,2002.Isolation of S-adenosyl-l-methionine from an enriched Kluyveromyces lactis mutant grown in whey media.Prikl.Biokhim.

Mikrobiol.38(4),389–392.

Park,J.H.,Tai,J.Z.,Roessner,C.A.,Sott,A.T.,1996.Enzymatic synthesis of S-adenosyl-l-methionine on the preparative scale.Bioorg.Med.Chem.4(12),2179–2185.

Ryu,K.,Kang,J.H.,Wang,L.,LeeJ,E.K.,2008.Expression in yeast of secreted lignin peroxidase with improved24-dichlorophenol degradability by DNA shuf?ing.

Biotechnology135(3),241–246.

Sambrook,J.,Russell,D.W.,2001.Molecular Cloning:A Laboratory Manual,third ed.

Cold Spring Harbor Laboratory Press,New York,NY.

Scorer,C.A.,Clare,J.J.,McCombie,W.R.,Michael,A.,Romanos,Sreekrishna,K.,1994.

Rapid selection using G418of high copy number transformants of Pichia pastoris for high-level foreign gene expression.Biotechnology12(2),181–184.

H.Hu et al./Journal of Biotechnology141(2009)97–103103

Shiozaki,S.,Shimizu,S.,Yamaha,H.,1984.Unusual intracellular accumulation of S-adenosyl-l-methionine by microorganisms.Arric.Biol.Chem.48,2293–2300. Shiozaki,S.,Shimizu,S.,Yamada,H.,1986.Production of S-adenosyl-l-methionine by Saccharomces sake.J.Biotechnol.4(6),345–354.

Shobayashi,M.,Mukai,N.,Iwashita,K.,Hiraga,Y.,lefuji,H.,2005.A new method for isolation of S-adenosylmethionine(SAM)-accumulating yeast.Appl.Microbiol.

69,704–710.

Stemmer,W.P.C.,1994.DNA shuf?ing by random fragmentation and reassem-bly:in vitro recombination for molecular evolution.Proc.Natl.Acad.Sci.91, 10747–10751.

Suen,W.C.,Zhang,N.,Xiao,L.,Madison,V.,Zaks,A.,2004.Improved activity and thermo-stability of Candida antarctica lipase B by DNA family shuf?ing.Protein.

Eng.Des.Sel.7(2),133–140.

Takusagawa,F.,Kamitori,S.,Misaki,S.,George,D.M.,1996.Crystal structure of S-adenosylmethionine synthetase.J.Biol.Chem.271(1),136–147.Tatsuya,T.,Yoshinori,H.,2007.Development of innovative Pediocin PA-1by DNA Shuf?ing among Class IIa Bacteriocins.Appl.Environ.Microbiol.73,5292–5299.

Wanger,J.,Danzin,C.,Huot-Olivier,S.,Claveric,N.,Palfreyman,M.G.,1984.High performance liquid chromatographic analysis of S-adenisylmethionine and its metabolites in rat tissues:interrelationship with changes in biogenic catechol levels following treatment with l-dopa.J.Chromatogr.290,247–262.

Yang,J.,Wang,M.,Sun,J.,Wei,P.H.,Tang,W.G.,2002.Cloning of S-adenosyl-l-methionine synthetase gene from Saccharomyces ceverisiae and its expression in E.coli.J.China Pharm.Univ.3,253–255.

Yu,Z.L.,Wu,X.J.,Li,D.Y.,Yang,S.,Zhou,Z.,Cai,J.Z.Y.,2003.Enhancement of the production of SAM by overexpression of SAM synthetase in Pichia pastoris.Sheng Wu Wu Li Xue Bao,Shanghai35,127–132.

Zhao,H.M.,Frances,H.A.,1997.Optimization of DNA shuf?ing for high?delity recom-bination.Nucleic Acids Res.25(6),1307–1308.