ER stress stimulates
ER stress stimulates production of the key antimicrobial peptide,cathelicidin,by forming a previously unidentified intracellular S1P signaling complex
Kyungho Park a,b ,Hiroko Ikushiro c,1,Ho Seong Seo d,1,Kyong-Oh Shin e ,Young il Kim a,b ,Jong Youl Kim b,f ,Yong-Moon Lee e ,Takato Yano c ,Walter M.Holleran a,b ,Peter Elias a,b ,and Yoshikazu Uchida a,b,2
a
Department of Dermatology,School of Medicine,University of California,San Francisco,CA 94158;b Northern California Institute for Research and Education,Veterans Affairs Medical Center,San Francisco,CA 94121;c Department of Biochemistry,Osaka Medical College,Takatsuki,Osaka 569-8686,Japan;d Radiation Research Division,Korea Atomic Energy Research Institute,Jeongeup 580-185,Republic of Korea;e College of Pharmacy,Chungbuk National University,Cheongju 361-763,Republic of Korea;and f Department of Endocrinology,School of Medicine,University of California,San Francisco,CA 94121
Edited by Sen-itiroh Hakomori,Pacific Northwest Research Institute,Seattle,WA,and approved January 19,2016(received for review March 5,2015)
We recently identified a previously unidentified sphingosine-1-phosphate (S1P)signaling mechanism that stimulates production of a key innate immune element,cathelicidin antimicrobial pep-tide (CAMP),in mammalian cells exposed to external perturbations,such as UVB irradiation and other oxidative stressors that provoke subapoptotic levels of endoplasmic reticulum (ER)stress,independent of the well-known vitamin D receptor-dependent mechanism.ER stress increases cellular ceramide and one of its distal metabolites,S1P,which activates NF-κB followed by C/EBP αactivation,leading to CAMP production,but in a S1P receptor-independent fashion.We now show that S1P activates NF-κB through formation of a previ-ously unidentified signaling complex,consisting of S1P,TRAF2,and RIP1that further associates with three stress-responsive proteins;i.e.,heat shock proteins (GRP94and HSP90α)and IRE1α.S1P specifically interacts with the N-terminal domain of heat shock proteins.Because this ER stress-initiated mechanism is operative in both epithelial cells and macrophages,it appears to be a universal,highly conserved response,broadly protective against diverse external perturba-tions that lead to increased ER stress.Finally,these studies further illuminate how ER stress and S1P orchestrate critical stress-specific signals that regulate production of one protective response by stim-ulating production of the key innate immune element,CAMP.
ER stress |sphingosine-1-phosphate |heat shock protein 90|cathelicidin |
innate immunity
M
ammalian epithelial tissues face hostile external environ-ments,where they are repeatedly bombarded by external perturbants,such as UV irradiation,oxidative stress and micro-bial pathogens that potentially threaten the integrity of epithelial and nonepithelial tissues/cells.Antimicrobial peptides (AMPs)represent highly conserved,innate immune elements that protect the host from microbial pathogens,while also signaling a variety of downstream responses that further fortify innate and adaptive immunity (1,2).We have shown that AMP production increases not only in response to microbial challenges,but also in response to a wide variety of other external perturbations that converge on the endoplasmic reticulum (ER),where AMP orchestrate a host of ER-initiated stress responses (3).Although high doses of ex-ternal perturbants can cause excessive ER stress,leading to in-creased production of the proapoptotic lipid ceramide,threatening cells with apoptosis (4,5),subtoxic levels of the same perturbants instead provoke lower levels of ER stress,with incrementally re-
duced ceramide production that rescues cells from apoptosis in part through metabolic conversion of ceramide to sphingosine-1-phosphate (S1P)(6).S1P in turn stimulates production of the key AMP,cathelicidin AMP (CAMP),and its downstream proteolytic product,LL-37,through transactivation of NF-κB –C/EBP α(7).This mechanism operates independently of the well-known vitamin D receptor-dependent mechanism,which instead regulates CAMP
synthesis under basal conditions (3,7).However,CAMP produc-tion is not only always beneficial:Although transient increases defend against microbial pathogens,sustained production of this AMP can stimulate downstream inflammatory responses,and even tumorigenesis (1).
S1P modulates a variety of cellular functions (e.g.,cell pro-liferation,differentiation and motility)through well-known G pro-tein coupled,S1P receptor-dependent mechanisms (8).However,we showed recently that ER stress-stimulated CAMP production is likely receptor-independent (7).Although prior studies showed that ER stress activates NF-κB via plasma membrane-localized S1P1,S1P2,and S1P3receptor activation (9,10),using specific activators/agonists and inhibitors/antagonists of all five identified S1P receptors (S1P1–S1P5),we showed that these pharmacolog-ical interventions did not modify the ER stress-induced increase in CAMP expression (7).Although prior study shows that TNF αreceptor activation can initiate S1P binding to TRAF2on plasma membrane,forming a signaling complex (S1P –TRAF2–TRADD –RIP1)that activates NF-κB (11),this mechanism does not appear to regulate CAMP synthesis.Instead,we identify and delineate a previously unidentified TNF αreceptor-and a S1P receptor-independent mechanism that regulate CAMP production through intracellular assembly of a S1P –TRAF2-stress-responsive protein signaling complex that forms in response to ER stress.Elucidation Author contributions:K.P.and Y.U.designed research;K.P.,H.I.,H.S.S.,K.-O.S.,Y.i.K.,and J.Y.K.performed research;K.P.,H.I.,K.-O.S.,Y.-M.L.,T.Y.,W.M.H.,and Y.U.analyzed data;K.P.,P.E.,and Y.U.wrote the paper;Y.U.developed the concept;Y.U.designed experi-ments;and Y.U.directed the project.The authors declare no conflict of interest.This article is a PNAS Direct Submission.
1H.I.and H.S.S.contributed equally to this work.
2
To whom correspondence should be addressed.Email:Yoshikazu.Uchida@https://www.360docs.net/doc/ad6181862.html,.
This article contains supporting information online at https://www.360docs.net/doc/ad6181862.html,/lookup/suppl/doi:10.1073/pnas.1504555113/-/DCSupplemental .
E1334–E1342|PNAS |Published online February 22,https://www.360docs.net/doc/ad6181862.html,/cgi/doi/10.1073/pnas.1504555113
鞘氨醇
神经酰胺
of this previously unidentified regulatory mechanism could point to potentially previously undeveloped therapeutic approaches to ei-ther enhance innate immunity or to suppress excessive CAMP production causing inflammation and tumorigenesis.Results
S1P Generated by SPHK1Stimulates CAMP Production Through S1P Receptor-Independent Activation of NF-κB in Response to ER Stress.
Because mammalian epidermis is continuously threatened by the external environment,we used cultured human epidermal ker-atinocytes (KC)as our primarily model in these studies.
Our prior study characterized that S1P generated by sphingo-sine kinase (SPHK)1activates NF-κB,leading to stimulation of CAMP production in KC in response to ER stress (7).Consistent with this prior study (7),increased S1P and CAMP production in response to ER stress [induced by an ER stressor,thapsigargin (Tg)that releases Ca 2+from ER by inhibition of sarco-ER Ca 2+-ATPases;ref.12]were suppressed by a specific inhibitor of SPHK1,PF-543,which significantly inhibited an isoform of SPHK,SPHK1,but not SPHK2,at concentrations ≥1μM in KC (Fig.1A –C )without decreasing cell viability and proliferation.We further confirmed that S1P generated by SPHK1stimulated CAMP production using SPHK1-null mice skin and SPHK1-silenced cells.Expected ER stress-induced stimulation of CAMP mRNA and protein pro-duction did not occur in SPHK1-null mice skin (Fig.1D and E )and SPHK1-silenced KC (SI Appendix ,Figs.S1A and S2C ).In addition,increased phosphorylation of I κB αand nuclear trans-location of NF-κB were abrogated in SPHK1-silenced cells (SI Appendix ,Fig.S1B and C ).As shown in our prior study (7),exogenous S1P increased CAMP production (SI Appendix ,Fig.S2A and C ).Whereas CAMP up-regulation did not occur in SPHK1-silenced KC in response to ER stress,exogenous S1P stimulated CAMP production in both SPHK1siRNA and control (scram-bled)siRNA transfected KC (SI Appendix ,Fig.S2C ),further
supporting the idea that S1P generated by SPHK1is responsible for stimulation of CAMP production.Moreover,Lys63(K63)-linked polyubiquitination of RIP1,which is required for NF-κB activation,was suppressed by a blockade of SPHK1using PF-543or SPHK1siRNA (Fig.2A and D ).These results ascertained our prior find-ings that S1P signaling generated by SPHK1is essential for ER stress-induced CAMP expression through NF-κB activation.
Although previous findings showed that ER stress activates NF-κB via S1P1,S1P2,and S1P3receptor activation (9,10),our prior studies revealed that pharmacological interventions using specific activators/agonists and inhibitors/antagonists of all five identified S1P receptors (S1P1–S1P5)did not modify the ER stress-induced increase in CAMP expression (7).We first con-firmed whether S1P-mediated stimulation of CAMP expression in vivo is S1P receptor-independent.Topical applications of Tg pro-duced comparable increases in mRNA and protein production of the murine homolog of CAMP (13)in the epidermis of S1P1-,S1P2-,and S1P3-null and wild-type mice (SI Appendix ,Fig.S3A ,B ,D ,and E ).Pertinently,topical Tg also comparably increased murine CAMP (mCAMP)expression in S1P1and S1P3double knockout mice (SI Appendix ,Fig.S3C and F ).Notably,topically applied Tg did not appear to be toxic to the skin of S1P1-3single,double knockout,or wild-type mice under these conditions;i.e.,neither epidermal hyperplasia nor dermal inflammation became evident in hematoxylin and eosin-stained sections from Tg-treated mice (SI Appendix ,Fig.S4).Finally,although S1P4and S1P5have not been shown to be activated by ER stress (9,10),we further excluded possibilities of S1P4and S1P5by a gene silencing ap-proach.Increases in CAMP production were not affected in cells in which S1P4or S1P5was knocked down by siRNA (SI Appendix ,Fig.S3G and H ).These studies further confirmed that the ER stress-induced increase in CAMP production is operative not only in vitro,but also in vivo,where it regulates CAMP production in an S1P receptor-independent fashion.
Fig.1.ER stress-mediated S1P production by SPHK 1induces CAMP production.KC pretreated with PF-543(at indicated concentrations)was incubated with Tg for 24h.(A )S1P and dihydro-S1P contents were assessed by LC-ESI-MS/MS.(B )CAMP mRNA levels were assessed by qRT-PCR.(C )Specificity of PF-543was confirmed by SPHKs activity assay (see details in Materials and Methods ).SPHK1null mouse skin was obtained 24h following topical application (20μL/cm 2)of Tg (100nM)or vehicle (DMSO)on dorsal skin.(C and D )Murine CAMP (mCAMP)mRNA (C )and protein (MW 18kDa)(D )levels were assessed by qRT-PCR or Western blot analysis,respectively.1mCathelin,an N-terminal domain of mCAMP.
Park et al.
PNAS |Published online February 22,2016|E1335
B I O
C H E M I S T R Y P N A S P L U S
S1P Receptor-Independent CAMP Induction Requires the Stress-Responsive ER Localizing Protein,IRE1α.Because ER stress can stimulate TNF α
production (14),we next investigated whether S1P-mediated TNF αreceptor (TNFR)-dependent formation of the signaling complex,S1P –TRAF2–TRADD –RIP1(11),is responsible for the S1P-induced activation of NF-κB that leads to increased CAMP production in response to ER stress.KC were pretreated with either a specific TNFR inhibitor or anti-TNF αneutralizing antibody,followed by exposure to the ER stressors,Tg or tunicamycin (Tm)(the latter triggers ER stress by inhibiting N -glycosylation).We first confirmed that TNFR activation,assessed as changes in the expression of three known TNFR regulating genes (i.e.,MMP-9,ICAM1,and IL-8),increases following exogenous TNF α(SI Appendix ,Table S1).However,neither treatment with a TNFR inhibitor nor treatment with the anti-TNF αneutralizing antibody altered ER stress-induced CAMP production (SI Appendix ,Table S1).These results indicate that the ER stress-induced increase in CAMP production occurs independently of TNFR-mediated activation.
Alternatively,TRAF2forms a signaling complex with an ER transmembrane molecule,IRE1α,which is activated by endor-ibonuclease,leading to NF-κB activation following imposition of ER stress (15,16).Because IRE1αserves as a part of a molec-ular complex that activates NF-κB,we next assessed whether IRE1αis required for ER stress-induced CAMP production.siRNA directed against IRE1α,but not scrambled siRNA,sig-nificantly attenuated CAMP production following ER stress [by either Tg (Fig.3A –C )or Tm (SI Appendix ,Fig.S5A )].Furthermore,both Western blot and immunofluorescence analyses revealed that
silencing of IRE1αdiminished ER stress-induced NF-κB activa-tion,including phosphorylation of I κB,as well as nuclear trans-location of both the p65and p50,isoforms of NF-κB (Fig.3D and E and SI Appendix ,Fig.S5B and C ).Thus,ER stress-induced CAMP production requires IRE1α-mediated activation of NF-κB.
ER Stress-Induced NF-κB Activation Stimulates Formation of a S1P-Mediated TRAF2Signaling Complex.Although TNF αreceptor activation does
not mediate the ER stress →↑NF-κB →↑CAMP mechanism,IRE1α,which we showed above is required for this signaling pathway,can form a complex with TRAF2(15,16).Moreover,TRAF2-mediated NF-κB activation requires RIP1polyubiquitination by an E3ligase contained in TRAF2,releasing I κB (17).To further characterize TRAF2-mediated NF-κB activation,we assessed IKK activation,which occurs following RIP1polyubiquitination.As expected,RIP1polyubiquitination became evident in KC following ER stress (Fig.2).In addition,a known RIP1polyubiquitination consequence,JNK phosphorylation,also occurred in KC exposed to ER stress (Fig.3F ).Hence,we next assessed whether silencing TRAF2alters ER stress-induced increases in CAMP expression.Because siRNA against TRAF2significantly suppresses CAMP production,TRAF2likely is also involved in the ER stress-induced stimulation of CAMP production (SI Appendix ,Fig.S6).
We next investigated whether IRE1αactivation of RIP1,which is polyubiquitinated at the Lys63in the IRE1α-TRAF2-containing signaling complex,is required for ER stress-initiated NF-κB acti-vation.Lys63-linked polyubiquitination of RIP1in response to ER stress was markedly decreased in IRE1α-silenced KC,indicating a
Fig.2.IRE1αand S1P generated by SPHK1are required for ER stress-induced polyubiquitination of RIP1.KC preincubated with PF-543(1μM,2–4h)(A )or transfected SPHK1siRNA (B –D ),SPHK2siRNA (B –D ),IRE1αsiRNA (E and F ),or scrambled control siRNA were incubated with Tg (20nM)for 10min.Lysates from cells were immunoprecipitated with anti-RIP1antibody (A ,C ,D ,and F )and immunoblotted with K63-specific polyubiquitin antibody (A ,D ,and F )or ubiquitin antibody (C ).SPHK1(B ),SPHK2(B ),or IRE1α(E )protein levels were assessed by Western blot analysis.
E1336|https://www.360docs.net/doc/ad6181862.html,/cgi/doi/10.1073/pnas.1504555113
Park et al.
requirement of IRE1αfor the polyubiquitination of RIP1in re-sponse to ER stress (Fig.2E and F ).
We first confirmed that silencing of IRE1αdoes not suppress an ER stress-mediated increase in S1P production (SI Appendix ,Fig.S7).We then investigated the role of S1P in RIP1poly-ubiquitination by blocking SPHK1and SPHK2.Although siRNA against SPHK1as well as a specific inhibitor of SPHK1,PF-543,markedly inhibited both polyubiquitination of RIP1and Lys63-linked polyubiquitination of RIP1following ER stress (Fig.2A ,C ,and D ),knockdown of SPHK2only slightly reduced poly-ubiquitination of RIP1(Fig.2C ).Moreover,silencing of SPHK1attenuated the ER stress-induced phosphorylation of I κB,as well as the nuclear translocation of NF-κB (SI Appendix ,Fig.S1B and C ).We next assessed the relationship between TRAF2and S1P-dependent RIP1polyubiquitination.SPHK1siRNA significantly diminished TRAF2binding to RIP1in cells exposed to ER stress (SI Appendix ,Fig.S8C and D ),indicating that S1P is required for TRAF2binding to RIP1.Together,these results indicate that S1P generation in response to ER stress is responsible for polyubiquitination of RIP1,and furthermore,that IRE1αis re-quired for the formation of the TRAF2–Lys63polyubiquitinated RIP1signal complex that results in canonical NF-κB activation.
Identification of Heat Shock Proteins in the S1P-Mediated Signaling Complex.Because the results described above show that an S1P-
mediated signaling complex with TRAF2activates NF-κB,we next investigated whether S1P-conjugated beads (S1P beads)bind to TRAF2following ER stress.Although Western blot analysis did not show detectable binding of TRAF2to S1P beads,we detected other unidentified bands in SDS/PAGE gels of such S1P bead-exposed protein https://www.360docs.net/doc/ad6181862.html,ing LC-MALDI TOF-MS,we sub-sequently identified two heat shock proteins (HSP)90s;i.e.,HSP90αand the ER resident HSP90,GRP94,within this complex.In addition,β-actin,desmoplakin,myosin-9,and tubulin bound to
the S1P beads,but neither TRAF2nor IRE1αwere detected by MS analyses.Although recent studies show that IL-1induces IRF1(IFN-regulatory factor 1)following S1P binding to cIAP2(18),cIAP2was not detected in the S1P bead complexes by MS analyses.Both HSP90αand GRP94function as molecular chaperones that maintain cellular functions in cells exposed to ER stress (19).Hence,HSP90s could play a role in S1P receptor-dependent NF-κB activation.Because HSP90s contain loop structures that often bind electrostatically (nonspecifically)to contiguous molecules,accordingly,we next assessed whether binding of HSP90αor GRP94to S1P beads is specific or nonspecific.Both HSP90αand GRP94were recovered from S1P beads incubated with ER-stressed KC lysates,but not from control beads (Fig.4A ).How-ever,HSP90βdid not bind to either S1P beads or control beads (Fig.4A ).In addition,recombinant HSP90αand GRP94bind to S1P beads (Fig.4B ).These results indicate that S1P exhibits a specific binding affinity toward HSP90αand GRP94.To further confirm S1P binding to HSP90,as well as quantitatively measuring S1P content in S1P-HSP90αin cells following ER stress,we assessed S1P content in immunoprecipitates of HSP90αor TRAF2isolated from TRAF2overexpressed KC lysates following either Tg or TNF αtreatments.LC-ESI-MS/MS analysis demonstrated that consistent with prior studies,S1P binds to TRAF2in cells in response to TNF αreceptor activation (Fig.4C and SI Appendix ,Fig.S9F ).Different from TNF αreceptor activation (11),S1P did not bind to TRAF2in ER stressed cells (Fig.4C and SI Appendix ,Fig.S9E ).Instead,S1P binds to HSP90α,but not TRAF2,in KC following ER stress (Fig.4C and SI Appendix ,Fig.S9B ).In contrast to S1P,dihydro-S1P did not bind to TRAF2or HSP90α(SI Appendix ,Fig.S9H and L ).
Because prior studies showed that HSP90αforms a complex with RIP1that results in NF-κB activation (20),we next assessed whether S1P beads bind to one or both of these HSP90family proteins,followed by formation of the signal complex that activates
Fig.3.IRE1is required for ER stress-induced CAMP production through NF-κB activation.KC transfected with IRE1αor scrambled control siRNA were exposed to Tg (20nM).(A –C )mRNA and protein levels of CAMP or IRE1αwere assessed by qRT-PCR (A ),Western blot (B ),or immunofluorescence staining (C ).(D )Alterations of phosphorylated I κB α,I κB β,isoforms of NF-κB,p50and p65,and IRE1αlevels were assessed by Western blot analysis.(E )Nuclear translo-cations of NF-κB were also assessed by immunofluorescence staining.(F )Phosphorylations of IKK α/βand JNK,and IKK protein levels were assessed by Western blot analysis.Green and blue staining corresponds to CAMP (C )or NF-κB (E ),and nucleus,respectively.
Park et al.
PNAS |Published online February 22,2016|E1337
B I O
C H E M I S T R Y P N A S P L U S
NF-κB,along with RIP1.Because IRE1αis a client protein of HSP90s (21),we next examined whether IRE1αis required for in-teraction with S1P to either HSP90αor GRP94.siRNA silencing of IRE1αabolished binding of both HSP90αand GRP94to S1P beads in cells exposed to ER stress (Fig.4D ),indicating that IRE1αis re-quired for S1P interaction with HSP90αand GRP94.Together,these studies show that S1P recruits a family of stress responsive proteins,including IRE1α,HSP90α,and GRP94,which activate NF-κB.
HSP90s Are Required for ER Stress-Induced Stimulation of CAMP Production.We next addressed whether HSP90αand/or GRP94
are required for ER stress-induced NF-κB activation,leading in turn to increased CAMP production.We first noted that silencing
of HSP90does not suppress ER stress-mediated increases in S1P (SI Appendix ,Fig.S7).Pretreatment of ER-stressed KC with geldanamycin (GA),a specific inhibitor of HSP90,significantly attenuated the expected increase in CAMP production (Fig.5A –E ),diminishing ER stress-induced phosphorylation of I κB (Fig.5F ),as well as the subsequent translocation of both the p50and p65NF-κB isoforms from the cytosol to the nucleus (Fig.5G )and K63-polyubiquitination of RIP1(Fig.5H ).Moreover,siRNA-induced silencing of either HSP90αor GRP94diminished the ER stress-induced increase in CAMP production,and double knock-down of both HSP90s further attenuated the expected ER stress-induced stimulation of CAMP (SI Appendix ,Fig.S10A –C ).Finally,decreased CAMP production in these knockdown experiments
was
Fig.4.S1P interacts with HSP90αand GRP94.(A and B )Control or S1P beads were incubated with lysates of Tg (20nM)-treated KC (A ),purified GRP94,and HSP90α(B ).(D )Lysates of KC transfected with IRE1αsiRNA or scrambled siRNA following exposure to Tg (20nM).(E )Purified HSP90αand GRP94preincubated with ATP (1mM)(E ).(A ,B ,D ,and E )The bound proteins were released from beads by boiling in SDS-sample buffer and were assessed by Western blot analysis with indicated antibodies.(C )Lysates from pTRAF2-GFP –overexpressed KC incubated with Tg (20nM)or TNF α(10ng/mL)were immunoprecipitated with anti-HSP90αor anti-TRAF2antibodies,and bound S1P content was determined by LC-ESI-MS/MS.(F )Recombinant HSP90α.Schematic diagram of deletion constructs of HSP90α.Full length (Full),N-terminal (N),or middle/C-terminal (MC)domains of HSP90αwere successfully overexpressed in Escherichia coli and purified.(G )The quality of recombinant HSP90α.The purity of recombinant HSP90αwas assessed with SDS/PAGE stained with coomassie brilliant blue.(H )S1P-,sphingosine-,or control-bead binding of the purified full length/deletion constructs of HSP90αwas also assessed by Western blot analysis with HRP-conjugated anti-His6antibody (proteins were eluted from beads by buffer containing 0.1mg/mL S1P).(I )Specific binding affinity of the purified full length and N-terminal domain of HSP90αto S1P was assessed by Bio-Layer Interferometry (Octet).
E1338|https://www.360docs.net/doc/ad6181862.html,/cgi/doi/10.1073/pnas.1504555113
Park et al.
paralleled by reduced translocation of NF-κB from the cytosol to the nucleus in these cells (SI Appendix ,Fig.S10D ).Therefore,both cytosolic HSP90αand ER resident GRP94are required for S1P-dependent NF-κB activation,leading to increased CAMP production.
Further Characterization of the S1P-Mediated Signaling Complex.
Because HSP90αassociates with a cochaperone,E3ubiquitin li-gase STIP1homology,and U-Box containing protein 1(STUB1)(22),we next assessed whether STUB1is required for the NF-κB –induced enhancement of CAMP production following ER stress.CAMP expression declined significantly in KC transfected with siRNA against STUB1,indicating an involvement of STUB1in RIP1polyubiquitination (SI Appendix ,Fig.S6).However,TRAF2also contains the TRAF2RING domain,E3ubiquitin ligase (17).Hence,it remains possible that both STUB1and the TRAF2RING domain,E3ubiquitin ligases,could contribute to RIP1ubiquitination under ER stressed conditions.
We next assessed the binding partners of the intracellular sig-naling complex.Immunoprecipitation studies show that the ER residential heat shock protein,GRP94,is already bound to IRE1αunder basal conditions,and that blockade of S1P production by SPHK1siRNA did not affect binding of IRE1αto GRP94under either basal or ER-stressed conditions (SI Appendix ,Fig.S8E ).Moreover,neither R1P1nor TRAF2was recovered from immu-noprecipitates preexposed to the GRP94antibody (SI Appendix ,Fig.S8E ).Likewise,HSP90αimmunoprecipitation studies dem-onstrated only low background levels of IRE1αbound to HSP90αunder both basal and ER stressed conditions (SI Appendix ,Fig.S8F ).In contrast,HSP90αbinding to RIP1was evident in immunopreci-pitated fractions following ER stressed condition,whereas this association was significantly declined in SPHK1-silenced KC
(SI Appendix ,Fig.S8F ).Similar to GRP94,TRAF2bands were not observed in immunoprecipitated fractions (SI Appendix ,Fig.S8F ).Finally,consistent with prior studies (11,23),SPHK1bound to TRAF2(SI Appendix ,Fig.S8A ).However,it still remains un-known whether a preformed pool of GRP94,bound to IRE1αunder basal conditions,is selectively recruited and contributes to formation of the signaling complex,or whether free IRE1αalso is used.Nonetheless,taken together with prior studies that show IRE1α–TRAF2binding (15,16),we can now predict the likely interaction/binding partners and member architecture of the S1P intracellular signaling complex (Fig.6).
HSP90families contain three conserved functional domains:an N-terminal ATP-binding domain required for dimerization fol-lowing ATP binding;a middle domain containing a client protein binding sequence;and a C-terminal spontaneous dimerization do-main with an alternative ATP-binding site (24).Preincubation of recombinant HSP90αand GRP94with ATP enhanced the binding of both HSP90αand GRP94to S1P beads (Fig.4E ).Thus,ATP-dependent dimerization of HSP90αand GRP94allows more effi-cient interaction of S1P with these HSP90s.
The S1P beads binding assay using recombinant HSP90αdem-onstrated that the full-length and the N-terminal portion of HSP90bound to only S1P beads but neither to sphingosine beads nor control beads.However,the middle/C-terminal domain of HSP90αdid not bind at all to the beads examined (Fig.4F –H ).Finally,we assessed the S1P interaction domain of HSP90αusing a sensitive,quantitative method;i.e.,interferometry.Consistent with the S1P beads binding assay,S1P bound to full-length and N-terminal do-main of HSP90α[K d of 120and 75μM,respectively;because these K d are determined by Bio-Layer Interferometry (Octet)in vitro,these values should not be the same as S1P –HSP90αbinding in
Fig.5.A family of HSP90proteins is required for increased CAMP production initiated by ER stress.KC-pretreated HSP90inhibitor,GA (0.5μM),was exposed to Tg for 24h.CAMP mRNA (A )and peptide/protein (B –E )were assessed by qRT-PCR (A ),Western blot (B ),immunofluorescence (C ),or ELISA analysis (D and E ).(F )Alterations of phosphorylated I κB α,I κB β,and NF-κB isoforms (p50and p65)in cytosolic (Upper )and nuclear (Lower )fractions were measured by Western blot analysis.Nuclear translocations of NF-κB were assessed by immunofluorescence.(H )Lysates from cells treated with Tg and/or GA were immunoprecipitated with anti-RIP1antibody and immunoblotted with K63-specific polyubiquitin antibody.
Park et al.
PNAS |Published online February 22,2016|E1339
B I O
C H E M I S T R Y P N A S P L U S
physiological conditions in cells](Fig.4I ).However,S1P did not bind to the middle/C-terminal domain of HSP90α(Fig.4I ).Moreover,neither of two structurally related lipids,sphingosine nor lysophosphatidic acid,bound to HSP90α(SI Appendix ,Fig.S11).Together,these studies demonstrate that S1P specifically interacts with the N-terminal domain of HSP90α.
The S1P-Mediated Signaling Complex Regulates Innate Immunity in Multiple Cell and Tissue Types.As we reported previously,ER stress
induces CAMP expression both in primary normal human KC,as well as in other epithelial cell types;i.e.,HeLa and HaCaT cells (3).We next investigated the role of HSP90s in the S1P-dependent increase in CAMP production,following ER stress administrated to other epithelial and nonepithelial cell types,including the human alveolar epithelial cell line,A549.Activation of XBP1(ER stress marker)became evident in A549cells,sug-gesting that ER stress occurs under comparable conditions in these cells (SI Appendix ,Fig.S12A ).CAMP mRNA levels also increased significantly in these cells under these conditions,whereas pretreatment with the HSP90inhibitor,GA,significantly attenuated the expected ER stress-induced increase in CAMP expression in A594cells (SI Appendix ,Fig.S12B ).Because CAMP also is produced by macrophages,we next assessed whether ER
stress-initiated increases in CAMP production also occurs in murine macrophages (RAW264.7)cell line through the S1P –HSP90–NF-κB mechanism.CAMP mRNA levels increased in RAW264.7cells following ER stress,whereas GA again sup-pressed the expected increase in CAMP expression in these cells (SI Appendix ,Fig.S12B ).Finally,inhibition of SPHK1suppressed CAMP production in both A549and RAW264.7cells without suppressing ER stress (SI Appendix ,Fig.S12C and D ).Together,these results indicate that the S1P-initiated signal complex oper-ates universally in both epithelial and nonepithelial cell types when subjected to ER stressed conditions.
Discussion
A variety of external insults,including UV irradiation and oxi-dative stress,induce ER stress.We have shown an enhancement of innate immunity through S1P-dependent transcriptional up-regulation of CAMP (3,7).We now show that S1P initiates such S1P receptor-independent signaling through a previously unidentified intracellular signaling complex,S1P –GRP94–IRE1α–TRAF2–RIP1–HSP90α–S1P,which in turn activates NF-κB,leading to increased CAMP production (Fig.6).Consistent with prior studies (11,23),SPHK1binds to TRAF2in KC,and this interaction
Fig.6.Proposed S1P-mediated signaling complex activates NF-κB,leading to stimulation of CAMP production.Increased cellular S1P in response to ER stress,which can be induced by external perturbations,specifically interacts with HSP90s (HSP90αand GRP94)to form a signaling complex with an ER residential stress responsive protein,IRE1α,TRAF2,and RIP1,leading to NF-κB activation that stimulates CAMP production.Both TRAF2-bound and unbound SPHK1could be responsible for a signaling complex formation.
E1340|https://www.360docs.net/doc/ad6181862.html,/cgi/doi/10.1073/pnas.1504555113
Park et al.
神经酰胺
鞘氨醇
significantly increases in cells in response to ER stress.However, in contrast to another NF-κB activation mechanism that requires S1P association with TRAF2in response to TNFαreceptor ac-tivation(11),S1P generated in response to ER stress interacts with HSP90s,independent of TNFαreceptor activation.Likely, the presence of IRE1αand HSP90s in this signaling complex prevents S1P from interacting with TRAF2,and/or the binding affinity of S1P to HSP90s could exceed the affinity of S1P for TRAF2binding in such conditions.
Although we focused here on S1P signaling of the innate immune element,CAMP,the participation of multiple S1P interacting/ binding partners,including TRAF2,cIAP2,HSP90α,GRP94, and S1P receptors,suggests that S1P could regulate diverse cel-lular functions through varying combinations of these binding partners in response to different stimuli,consistent with the di-verse roles of S1P in cells,including both pro-and antiapoptotic effects(25).We demonstrated that S1P specifically interacts with(binds to)N-terminal domain of HSP90α.A specific binding site(s)of S1P to S1P receptors have been largely characterized (26).However,likewise TRAF2and cIAP2,a specific interaction (binding)site(s)of S1P to HSP90s remains unknown.
S1P displays a specific interaction with an N-terminal domain in HSP90α,and addition of ATP increases the binding affinity of S1P to both HSP90αand GRP94.ATP binding to HSP90s leads to conformational changes at N-terminal toroidal structures that increase binding affinities with client proteins(24),likely also facilitating interaction of S1P to these HSP90s.Because both HSP90αand GRP94are highly conserved members of the HSP90family(27),S1P likely has the same interacting preference for GRP94as for HSP90α;i.e.,a comparable N-terminal domain structure.Further studies are still needed to identify the spe-cific S1P-binding sequence in the N-terminal domain of HSP90α, as well as other cofactors that regulate S1P binding to HSP90s and/or increases binding affinity to S1P–HSP90s interaction. Similar to previous findings that have been reported the K d values in micromolar(μM)to millimolar(mM)range for HSP90 binding to certain small molecules assessed by Octet(28,29),our Octet assay indicates the low-affinity binding S1P to HSP90s(K d: 75–120μM).However,in cells,the presence of ATP(Fig.4)and/ or unidentified possible cofactors could increase S1P–HSP90s binding affinity.
Importantly,S1P interaction with HSP90s was only detected following ER stress in the presence of IRE1α,suggesting that IRE1αforms a platform on the ER membrane that facilitates S1P association with GRP94,thereby initiating formation of the intracellular signaling complex.In contrast to cells/cell lysate systems,which contain numerous components that can interact with HSP90s and/or S1P,nonphysiologic(high)concentrations of S1P or purified recombinant HSP90s could induce this in-teraction in the absence of IRE1αas well as of another proteins.In addition,IRE1α–GRP94signaling platform in vivo(stable foun-dation)could allow S1P to interact with HSP90s;we speculate that, in in vitro studies using S1P beads and Octet system,S1P is conju-gated to agarose beads or to HSP90s that are immobilized onto the Ni-NTA sensor,both conditions that may provide a platform(or foundation).Similar to our findings in response to subtoxic levels of external perturbations that induce ER stress,preconditioning with hypoxia reportedly enhances cardioprotection through an S1P signal (30).Together,these studies suggest that subtoxic levels of ER stress exert broad benefits in cells,protecting cellular functions through S1P signaling.
Our prior(3,7)and present studies further illuminate how ER stress-mediated S1P production constitutes a metabolic rescue mechanism that protects against ceramide-induced apoptosis in re-sponse to external insults,in turn enhancing innate immunity through increased CAMP expression.These studies further suggest that pharmacological stimulation of S1P signaling mechanisms could represent a previously unidentified therapeutic approach to enhance antimicrobial defense through increased CAMP pro-duction.However,excessive and/or sustained elevations of cellular S1P and CAMP can increase inflammation and cancer develop-ment(31).Hence,interventions that interdict S1P signaling could be exploited as either anti-inflammatory and/or antineoplastic therapeutic strategy.
Materials and Methods
Reagents,antibodies,expression vectors,recombinant proteins,detailed methods for cell culture and transfection,mice and ex vivo studies,expression and/or purification of TRAF2and HSP90proteins,RNA isolation and quan-titative RT-PCR(qRT-PCR),Western blot analysis,ELISA for CAMP quantification, histological and immunofluorescence,immunoprecipitation,sphingolipids-coated bead binding assay,protein identification by mass spectrometry,bio-layer interferometry assay,S1P quantification,enzyme activity assays for sphingosine kinases,and statistical analysis used in this study can be found in SI Appendix,SI Materials and Methods.This study was approved by the Uni-versity of California,San Francisco,Institutional Review Board approval pro-tocol and the San Francisco VA Medical Center Institutional Animal Care and Use Committee.
ACKNOWLEDGMENTS.We thank Dr.Timothy Hla(Weill Cornell Medical College),Dr.Julie Saba(Children’s Hospital Oakland Research Institute),and Dr.Richard Proia for providing transgenic mice and useful suggestions; Dr.Julie Saba for critical review of the manuscript;Ms.Sally Pennypacker and Ms.Lillian Adame for technical support in cell culture;and Ms.Joan Wakefield for superb editorial assistance.We acknowledge the support of the Medical Research Services of the Veterans Affairs Medical Center,San Francisco.This study was supported by a Grant-in-Aid for Scientific Research(C)25440036 from the Japan Society for the Promotion of Science(JSPS)and the Japan Foundation for Applied Enzymology(to H.I.),the National Rosacea Society,the San Francisco Foundation,and National Institutes of Health Grants AR051077 and AR062025(the National Institute of Arthritis and Musculoskeletal and Skin Diseases)(to Y.U.).
1.Pasupuleti M,Schmidtchen A,Malmsten M(2012)Antimicrobial peptides:Key com-
ponents of the innate immune system.Crit Rev Biotechnol32(2):143–171.
2.Nakatsuji T,Gallo RL(2012)Antimicrobial peptides:Old molecules with new ideas.
J Invest Dermatol132(3Pt2):887–895.
3.Park K,et al.(2011)Regulation of cathelicidin antimicrobial peptide expression by an
endoplasmic reticulum(ER)stress signaling,vitamin D receptor-independent path-way.J Biol Chem286(39):34121–34130.
4.Lei X,Zhang S,Bohrer A,Ramanadham S(2008)Calcium-independent phospholipase
A2(iPLA2beta)-mediated ceramide generation plays a key role in the cross-talk be-tween the endoplasmic reticulum(ER)and mitochondria during ER stress-induced insulin-secreting cell apoptosis.J Biol Chem283(50):34819–34832.
5.Senkal CE,Ponnusamy S,Bielawski J,Hannun YA,Ogretmen B(2009)Antiapoptotic
roles of ceramide-synthase-6-generated C16-ceramide via selective regulation of the ATF6/CHOP arm of ER-stress-response pathways.FASEB J24(1):296–308.
6.Uchida Y,et al.(2010)Hydrolytic pathway protects against ceramide-induced apo-
ptosis in keratinocytes exposed to UVB.J Invest Dermatol130(10):2472–2480.
7.Park K,et al.(2013)A novel role of a lipid species,sphingosine-1-phosphate,in epi-
thelial innate immunity.Mol Cell Biol33(4):752–762.
8.Blaho VA,Hla T(2014)An update on the biology of sphingosine1-phosphate re-
ceptors.J Lipid Res55(8):1596–1608.
9.Blom T,et al.(2010)An autocrine sphingosine-1-phosphate signaling loop enhances
NF-kappaB-activation and survival.BMC Cell Biol11:45.
10.Ki SH,Choi MJ,Lee CH,Kim SG(2007)Galpha12specifically regulates COX-2induction
by sphingosine1-phosphate.Role for JNK-dependent ubiquitination and degradation of IkappaBalpha.J Biol Chem282(3):1938–1947.
11.Alvarez SE,et al.(2010)Sphingosine-1-phosphate is a missing cofactor for the E3
ubiquitin ligase TRAF2.Nature465(7301):1084–1088.
12.Inesi G,Wade R,Rogers T(1998)The sarcoplasmic reticulum Ca2+pump:Inhibition by
thapsigargin and enhancement by adenovirus-mediated gene transfer.Ann N Y Acad Sci853:195–206.
13.Gallo RL,et al.(1997)Identification of CRAMP,a cathelin-related antimicrobial peptide
expressed in the embryonic and adult mouse.J Biol Chem272(20):13088–13093.
14.Menon MB,et al.(2013)Endoplasmic reticulum-associated ubiquitin-conjugating
enzyme Ube2j1is a novel substrate of MK2(MAPKAP kinase-2)involved in MK2-mediated TNFαproduction.Biochem J456(2):163–172.
15.Urano F,et al.(2000)Coupling of stress in the ER to activation of JNK protein kinases
by transmembrane protein kinase IRE1.Science287(5453):664–666.
16.Kaneko M,Niinuma Y,Nomura Y(2003)Activation signal of nuclear factor-kappa B in
response to endoplasmic reticulum stress is transduced via IRE1and tumor necrosis factor receptor-associated factor2.Biol Pharm Bull26(7):931–935.
Park et al.PNAS|Published online February22,2016|E1341B I O C H E M I S T R Y P N A S P L U S
17.Li X,Yang Y,Ashwell JD(2002)TNF-RII and c-IAP1mediate ubiquitination and deg-
radation of TRAF2.Nature416(6878):345–347.
18.Harikumar KB,et al.(2014)K63-linked polyubiquitination of transcription factor IRF1
is essential for IL-1-induced production of chemokines CXCL10and CCL5.Nat Immunol15(3):231–238.
19.Hartl FU(1996)Molecular chaperones in cellular protein folding.Nature381(6583):
571–579.
20.Lewis J,et al.(2000)Disruption of hsp90function results in degradation of the death
domain kinase,receptor-interacting protein(RIP),and blockage of tumor necrosis factor-induced nuclear factor-kappaB activation.J Biol Chem275(14):10519–10526.
21.Marcu MG,et al.(2002)Heat shock protein90modulates the unfolded protein re-
sponse by stabilizing IRE1alpha.Mol Cell Biol22(24):8506–8513.
22.Galigniana MD,et al.(2004)Retrograde transport of the glucocorticoid receptor in
neurites requires dynamic assembly of complexes with the protein chaperone hsp90 and is linked to the CHIP component of the machinery for proteasomal degradation.
Brain Res Mol Brain Res123(1-2):27–36.
23.Xia P,et al.(2002)Sphingosine kinase interacts with TRAF2and dissects tumor ne-
crosis factor-alpha signaling.J Biol Chem277(10):7996–8003.24.Zuehlke A,Johnson JL(2010)Hsp90and co-chaperones twist the functions of diverse
client proteins.Biopolymers93(3):211–217.
25.Mendelson K,Evans T,Hla T(2014)Sphingosine1-phosphate signalling.Development
141(1):5–9.
26.Rosen H,Germana Sanna M,Gonzalez-Cabrera PJ,Roberts E(2014)The organization of
the sphingosine1-phosphate signaling system.Curr Top Microbiol Immunol378:1–21.
27.Chen B,Piel WH,Gui L,Bruford E,Monteiro A(2005)The HSP90family of genes in the
human genome:Insights into their divergence and evolution.Genomics86(6):627–637.
28.Song X,et al.(2015)Identification of epipolythiodioxopiperazines HDN-1and chae-
tocin as novel inhibitor of heat shock protein90.Oncotarget6(7):5263–5274.
29.Matthews SB,et al.(2010)Characterization of a novel novobiocin analogue as a
putative C-terminal inhibitor of heat shock protein90in prostate cancer cells.
Prostate70(1):27–36.
30.Karliner JS(2013)Sphingosine kinase and sphingosine1-phosphate in the heart:A
decade of progress.Biochim Biophys Acta1831(1):203–212.
31.Vandamme D,Landuyt B,Luyten W,Schoofs L(2012)A comprehensive summary of
LL-37,the factotum human cathelicidin peptide.Cell Immunol280(1):22–35.
E1342|https://www.360docs.net/doc/ad6181862.html,/cgi/doi/10.1073/pnas.1504555113Park et al.
SI Materials and Methods
Reagents and antibodies
Sphingosine-1-phosphate (S1P), sphingosine, and lysophosphatidic acid (LPA) were obtained from Echelon Biosciences. Thapsigargin (Tg) and tunicamycin (Tm) were from Sigma-Aldrich. TNFα was from Shenandoah Biotechnology and geldanamycin (GA) was from Cayman. TNFα inhibitor was from Calbiochem and TNFα neutralizing antibody was from Cell Signaling. Full length human recombinant HSP90α and GRP94 were from ProSpec. The following antibodies were used for western blot, immunoprecipitation, or immunofluorescence assay: rabbit monoclonal HSP90α, rabbit polyclonal HSP90β, rabbit polyclonal GRP94, rabbit monoclonal IRE1α, rabbit polyclonal TRAF2, rabbit monoclonal RIP1, rabbit monoclonal STUB1, rabbit monoclonal phospho-JNK
(Thr183/Tyr185), rabbit monoclonal phospho-IKK (Ser176/180), and rabbit polyclonal Histone H3 antibodies (Cell Signaling); mouse monoclonal p50, mouse monoclonal p65, rabbit polyclonal IκBβ, rabbit polyclonal phospho-IκBα, mouse monoclonal IKK, and rabbit polyclonal ubiquitin antibodies (Santa Cruz Biotechnology); mouse monoclonal HSP90α, rabbit polyclonal GRP94, rabbit polyclonal CAMP antibodies (LifeSpan Biosciences); mouse monoclonal RIP1 antibody (BD Bioscience); mouse monoclonal polyubiquitin (K63-linkage specific) antibody (Enzo Life Sciences); mouse monoclonal GFP antibody (Origene Technologies); monoclonal β-actin-peroxidase conjugated antibody (Sigma-Aldrich); rabbit polyclonal sphingosine kinase 1, mouse monoclonal sphingosine kinase 2 (ECM Biosciences); and mouse monoclonal HRP-conjugated His6 antibody (Medical & Biological Laboratories Co Ltd.).
Cell Culture
Because mammalian epidermis is continuously threatened by perturbants from the external environment, we employed cultured human epidermal keratinocytes (KC) as our primarily model for most of these studies. Normal human KC isolated from neonatal foreskins were grown in serum-free KC growth medium containing 0.07 mM calcium chloride and growth supplements (Invitrogen), as described previously (1) under the UCSF Institutional Review Board approval protocol. Human lung carcinoma A549 and macrophage cell line RAW264.7 were maintained in DMEM containing 10% FBS, respectively, as described previously (2). Culture medium was switched to KC growth medium containing reduced growth factor (to 50%) for KC and DMEM containing 1% FBS for other cells one day prior to treatment.
Animal and Ex vivo experiments
S1P1, S1P2, S1P3, or S1P1/3 receptors- and SPHK1-null mice were kindly provided by Drs. Timothy Hla (Weill Cornell Medical College), Richard L. Proia (National Institute of Health) and Julie Saba (Children's Hospital Oakland Research Institute). Mice are generated and genotyped as described previously (3). Ex vivo (organ culture) skin studies were conducted, as described previously (1). Briefly, full thickness pieces of murine skin harvested from each S1P receptors- or SPHK1-null mice or appropriate littermate controls (wild type) were placed on filter papers, dermis side down, and cultured at the air-medium interface in KC growth medium. Tg (100 nM) or vehicle (DMSO) was epicutaneously applied (20 μl/cm2) followed by incubation for 24 hrs. All experiments and procedures were performed according to protocols approved by the SFVAMC
Institutional Animal Care and Use Committee.
Expression of plasmid for TRAF2
The pCMV6-AC-TRAF2-GFP vector purchased from OriGene was used for overexpression of human TRAF2 gene. The plasmid was transformed into Escherichia coli DH5α and purified by Qiagen plasmid Midi prep system using standard methods (4).
Expression and Purification of Recombinant HSP90 proteins
The pCMV6-XL4-HSP90AA1 (Origene) was used as a template for PCR amplification of three DNA fragments coding the full length (Full) (Met1-Asp732), the N-terminal (N) domain (Met1-Glu236) or the middle and C-terminal (MC) domain (Lys293-Gly697) of HSP90 isoform 1. The PCR primers are listed below. Each PCR product of HSP90 was cloned into pET28b (Novagen) with the In-Fusion Advantage PCR cloning kit (Clontech). All plasmids were designed to express the recombinant protein with the His6-tags at both N- and C-termini, and the entire coding regions were checked by DNA sequencing. The resulting expression plasmids were transformed into Escherichia coli BL21 (DE3) strain and expressed for 4 hrs at 37 °C after induction with 1 mM isopropyl β-D-thiogalactopyranoside. Cells were harvested at 7,000 × g for 5 mins and resuspended in Buffer A (20 mM sodium phosphate pH 7.4, 0.5 M NaCl). Cells were disrupted by sonication, and cell debris was removed by centrifugation (15,000 × g, 30 mins, 4 °C). The cleared supernatants were loaded on a nickel-nitrilotriacetic acid-agarose column (HisTrap FF-1mL, GE Healthcare) operated on an ?KTA FPLC liquid chromatography system (GE Healthcare) pre-equilibrated with Buffer A, and His6-tagged proteins were
eluted using a linear 60-1000 mM imidazole gradient in Buffer A. Peak fractions were pooled, concentrated (10-kDa MWCO; Vivaspin? 20, Sartorius), and further purified on a HiTrap DEAE HP-1mL anion exchange chromatography column (GE Healthcare) pre-equilibrated with Buffer B (20 mM sodium phosphate, pH 7.4). Proteins were eluted by using a linear 0-500 mM NaCl gradient in Buffer B. The fractions were pooled and dialyzed against Buffer C (20 mM Tris-HCl, pH 7.4). The concentration of each HSP90 protein was determined by using the following extinction coefficient: ?280 = 59,850 M?1 cm?1 for the full length, ?280 = 16,065 M?1 cm?1 the N-domain, ?280 = 42,315 M?1 cm?1 for the MC-domain of HSP90.
List of primers for plasmid construction
HSP90α f1 (PCR for InFusion-cloning of HSP90α Full [1-732], CCGCGCGGCAGCCATATGCCTGAGGAAACC; HSP90α f2 (PCR for InFusioncloning of HSP90α N-domain [1-236]), CCGCGCGGCAGCCATATGGACCAACCGATG; HSP90α f2 (PCR for InFusioncloning of HSP90α MC-domain [293-697]), CCGCGCGGCAGCCATATGAAGCCCATCTGG; HSP90α r1 (PCR for InFusioncloning of HSP90α Full [1-732]), CTTGTCGACGGAGCTGTCTACTTCTTCCAT; HSP90α r2 (PCR for InFusion-cloning of HSP90α N-domain [1-236], CTTGTCGACGGAGCTTTCAGCCTCATCATC;
HSP90α r3 (PCR for InFusion-cloning of HSP90α MC-domain [293-697]), CTTGTCGACGGAGCTACCCAGACCAAGTTT; pET28α f (PCR of pET28 for InFusion-cloning), AGCTCCGTCGACAAGCTTGCGGCCGCACTC; pET28α r (PCR
of pET28 for InFusion-cloning), ATGGCTGCCGCGCGGCACCAGGCCGCTGCT; HSP90_200 (DNA sequence primer, GCATCTGTTGGTGTCTGGAT; HSP90α 800 (DNA sequence primer), GAAAGTAACTGTGATCAC; HSP90α 1400 (DNA sequence primer), TGCTCCTTTTGATCTGTTTG.
Quantitative RT-PCR
Relative mRNA expression was assessed by quantitative RT-PCR (q RT-PCR) using SensiMix TM SYBR PCR Master Mix (Bioline) as described previously (1). Briefly, Total RNA was isolated from cell lysates using RNeasy mini kit (Qiagen), followed by preparation of cDNA using SensiFAST TM cDNA synthesis kit (Bioline). The used primer sets for PCR are listed below and in our prior study (1). The thermal cycling conditions were 95?C for 10 mins, 95?C for 15 sec, 60?C for 15 sec, and 72?C for 15 sec, repeated 40 times on ABI Prism 7900HT (Applied Biosystems). mRNA expression was normalized to levels of GAPDH. Values shown represent mean (± SD) for three independent assays. The following primer sets were used: SPHK1, 5-CATCCAGAAGCCCCTGTGTAG-3’ and 5’-CTGCTCATAGCCAGCATAATGG-3’; SPHK2, 5-TGCTCCATGAGGTGCTGAAC-3’ and 5’-GCCCACAGGCATCTTCACA-3’; S1P4, 5-GTCTTTGGCTCCAACCTCTG-3’ and 5’-CTGCTGCGGAAGGAGTAGAT-3’; S1P5, 5-CGACAGAGATGGTGATGGTG-3’ and 5’-CTTTTGGTCTTCCCAGGACA-3’; ICAM-1, 5-CGTGGGGAGAAGGAGCTGAA-3’ and 5’-CAGTGCGGCACGAGAAATTG-3’; IL-8, 5-TCTGGCAACCCTAGTCTGCT-3’ and 5’-AAACCAAGGCACAGTGGAAC-3’; MMP-9, 5-TTGACAGCGACAAGAAGTGG-3’ and 5’-GCCATTCACGTCGTCCTTAT-3’.
Western blot analysis
Western blot analysis was performed as described previously (1). Cell lysates, prepared in radioimmunoprecipitation assay buffer, were resolved by electrophoresis on 4-12% Bis-Tris protein Gel (Invitrogen). Nuclear and cytoplasmic fractions were prepared using extraction reagents (Thermo Scientific),following the manufacturer’s instructions. Resultant bands were blotted onto polyvinylidene difluoride membranes, probed with appropriate antibodies, and detected using enhanced chemiluminescence (Thermo Scientific). The intensity of bands was measured with a LAS-3000 (Fuji Film).
ELISA for CAMP Quantification
CAMP content in cell lysates or conditioned medium was quantitated using an LL-37 human enzyme-linked immunosorbent assay (ELISA) kit (Hycult Biotech) in accordance with the manufacturer’s instructions.
Immunofluorescence
KC were pretreated with GA for 30 mins or were transfected with IRE1α, HSP90α, or GRP94 si RNA (20 nM) prior to incubation with Tg or Tm for the appropriate time period. CAMP or NF-κB distribution was assessed using anti-CAMP (LifeSpan BioSciences) or anti-NF-κB p65 (Santa Cruz Biotechnology), respectively. The secondary antibodies were Alexa Fluor? 488 goat anti-rabbit IgG, Alexa Fluor? 488 goat anti-mouse IgG, or Alexa Fluor? 568 donkey anti-rabbit IgG antibodies (Invitrogen). Cells were counterstained with the nuclear marker 4’,6-diamidino-2-phenylindole (DAPI)
(Vector Laboratories) for nuclear visualization.Slides were examined with a Carl Zeiss Axio fluorescence microscope.
Transfections of si RNAs or pTRAF2-GFP
KC were transfected with 20 nM si RNAs for IRE1α, SPHK1, SPHK2 (two sources
si RNA [Santa Cruz Biotechnology and Invitrogen] were used in different set of studies), HSP90α, GRP94 (Invitrogen), TRAF2, STUB1 (Santa Cruz Biotechnology), or scrambled control (Invitrogen) using siLentFect lipid reagent (Bio-Rad), as previously described (1). In some experiments, cells were transfected with different sequences of
si RNAs to exclude off-target effects. KC were transfected with pTRAF2-GFP using DNA transfection reagent, HilyMax (Dojindo).
Immunoprecipitation
Cell lysates were prepared in IP lysis/wash buffer (Thermo Scientific) containing protease inhibitor cocktail (Roche) and 1mg/ml N-ethylmaleimide in accordance with the manufacturer’s instructions. RIP1, GFP, HSP90α, or GRP94 were immunoprecipitated from 200 μg of cell lysates with 1 μg anti-RIP, anti-GFP, anti-HSP90α, or anti-GRP94 antibodies overnight at 4°C. Immunoprecipitates were captured with protein A/G plus agarose beads (Thermo Scientific). After extensive washing, bound proteins were released by boiling in SDS-PAGE sample buffer and performed western blot analysis.
Isolation of S1P binding proteins
Control-, S1P-, and sphingosine-coated beads (Echelon Biosciences) equilibrated with the binding/washing buffer (10 mM Hepes buffer pH 7.4, 150 mM NaCl, protease inhibitor cocktail, and 0.5% (v/v) Igepal were mixed cell lysates or recombinant HSP90s (full-length [full], Middle + C-terminal [MC] or N-terminal [N] domain) and incubated for 2 hrs with continuous motion at 4°C. The beads were washed 5 times with
binding/washing buffer. Proteins are eluted from beads by the binding/washing buffer containing 0.1 mg/ml of S1P or by boiling the beads with the SDS-PAGE sample buffer. The eluted proteins were analyzed by SDS-PAGE and western blotting.
Protein identification by Mass Spectrometry
Proteins were separated on a 4-12% gradient Bis-Tris protein gel (Invitrogen), bands were visualized by coomassie brilliant blue staining and then excised, followed by processing Mass Spectrometry at the Stanford University Mass Spectrometry facility. Briefly, gel was digested as previously described (5) using trypsin (Promega) for overnight at 37°C. Peptides were extracted from the gel bands subjected to LC-MS where the liquid chromatography was an Eksigent nano2D operated at 600 nL/min equipped with a Bruker Michrom Captive Spray source. The Mass Spectrometer was a LTQ Orbitrap Velos operated in data dependent acquisition (DDA) mode in which the most intense multiply charged precursor ions were selected and fragmented in the ion-trap. The data was searched using SEQUEST software (Thermo Fisher Scientific) on a Sorcerer platform, exported and visualized by Scaffold.
Bio-layer Interferometry Assay
S1P, sphingosine, or LPA bindings to the full length (Full), the N-terminal (N) domain, or the domain consisting of both middle and C-terminal (MC) domain of purified
HSP90α were measured by bio-layer interferometry on an Octet RED 384 system (ForteBio) at the Biosensor Core Facility, UCSF Center for Advanced Technology. Full, N, or MC domains of HSP90α equilibrated with PBS buffer were dispensed into 384-well plates at a volume of 100 μl per well. Operating temperature was maintained at 27°C with 1000 rpm rotary agitation. Ni-NTA biosensor tips (ForteBio) were pre-wet for 10 mins with buffer to establish a baseline before protein immobilization. First, Full of His6-tagged HSP90α proteins were capture-immobilized onto the biosensors for 2 mins at a concentration of 50 μg/ml. The immobilization level attained was 1.5 nm. Binding association of serial dilutions of each lipid with the Full of HSP90α-loaded biosensor tips was monitored for 30 sec, and subsequent disassociation in PBS buffer was monitored for 30 sec. Subsequently, N- or MC-domains of His6-tagged HSP90 proteins were immobilized onto the biosensor tips, which were regenerated by rinsing 40 sec in 0.3M imidazole, 0.05% SDS, followed by the determination of binding with each lipid as described above. The apparent affinities of HSP90 proteins with each lipid were calculated from steady-state response measurements (Octet User Software version 8.0).
S1P quantification
KC transfected with pTRAF2-GFP using DNA transfection reagent, HilyMax (Dojindo) for 24 hrs were incubated with Tg or TNFα for 10 mins. Cells were lysed in IP lysis/wash buffer (Thermo Scientific) containing protease inhibitor cocktail (Roche). HSP90α or TRAF2 were immunoprecipitated from 500 μg of cell lysates with 2.5 μg anti-HSP90α or
anti-TRAF2 antibodies overnight at 4°C. Immunoprecipitates were captured with protein A/G plus agarose beads (Thermo Scientific) and washed 4 times with IP lysis/wash buffer. To recover/extract sphingolipids bound HSP90α or TRAF2, 500 μl of 1% formic acid (v/v) in acetonitrile containing C17-S1P (20 pmol) as an internal standard was added and incubated at 60°C for 20 mins. The sphingolipid extraction was repeated by the addition of another 500 μl of 1% formic acid (v/v) in acetonitrile containing C17-S1P (20 pmol). The extracted lipids (total 1ml) dried using a vacuum system (Vision, Seoul, Korea) were re-dissolved in methanol and analyzed by LC-ESI-MS/MS (API 4000 QTRAP mass, AB/SCIEX) by selective ion monitoring mode (The precursor ions of S1P [m/z 380.3] and dihydro-S1P [m/z 382.3] were cleaved into fragment ions of m/z 264.2 and m/z 284.2, respectively) as described previously (6, 7). Data were analyzed using Analyst 1.4.2 software (Life Technologies).
Enzyme activity assays for SPHK1 and SPHK2
KC pretreated with a specific SPHK1 inhibitor, PF-543 (1 μM or 2.5 μM) for 30 mins were incubated with Tg (50 nM) for 24 hrs. SPHK1 and SPHK2 activities were determined as described previously (8, 9). Briefly, cell lysates in 20 mM Tris (pH7.4) containg 5 mM EDTA, 5 mM EGTA, 3 mM β-mercaptoethanol, 5% glycerol, protease inhibitors (Sigma-Aldrich) and phosphatase inhibitors (Roche) were incubated with 10 μL of 200 μM C17-Sphingosine as a SPHK substrate. To assay each isoform of SPHK activity, 0.5% Triton X-100 or 1 M KCl (for SPHK 1 and SPHK2, respectively) were added into assay buffer and then incubated at 37°C for 30 mins. Enzyme reactions were terminated by the addition of CHCl3: MeOH: HCl (8:4:3, v/v/v). C17-sphinganine-1-
phosphate (100 pmol) was added as an internal standard. The organic phage separated by addition of CHCl3 was dried using a vacuum system (Vision). The dried residue was re-dissolved in MeOH and then analyzed by LC-ESI-MS/MS (API 3200 Triple quadruple mass, AB/SCIEX) as above and the activities of SPHK1 and SPHK2 are expressed as
C17-S1P pmol per mg protein per min.
Statistical analyses
Experiments were repeated at least three times. For each experiment, results from triplicate samples were expressed as the mean ± standard deviation (SD). Significance between groups was determined with unpaired Student t test. The P values were set at
<0.01.
REFERENCES
1.Park K, et al. (2011) Regulation of Cathelicidin Antimicrobial Peptide Expression by
an Endoplasmic Reticulum (ER) Stress Signaling, Vitamin D Receptor-independent Pathway. J Biol Chem 286: 34121-34130.
2.Lieber M, Smith B, Szakal A, Nelson-Rees W, & Todaro G (1976) A continuous
tumor-cell line from a human lung carcinoma with properties of type II alveolar epithelial cells. Int J Cancer 17: 62-70.
3.Skoura A, et al. (2011) Sphingosine-1-phosphate receptor-2 function in myeloid cells
regulates vascular inflammation and atherosclerosis. Arterioscler Thromb Vasc Biol 31: 81-85.