Altered circadian rhythms regulate growth vigor in hybrids and allopolyploids

Keywords circadian clock; polyploidy; hybrid vigor; epigenetics; gene expression; biomass Polyploidy (whole genome duplication) is an evolutionary innovation in many plants and some animals. Many important crops such as wheat, cotton, and canola are of allopolyploidy that contains two or more divergent genomes 14,15, and some plants and animals exist as interspecific hybrids 16. The common occurrence of polyploids suggests an evolutionary advantage of having additional genetic materials for growth and adaptation. Moreover,heterozygosity and novel genomic interactions in allopolyploids induce phenotypic variation and growth vigor 15.In stable allotetraploids that were resynthesized by interspecific hybridization between A.thaliana and A. arenosa (Supplementary Fig. 1)4, over 1,400 genes (>5% and up to 9,800 genes or ～38%) were nonadditively expressed 1. Nonadditive expression indicates that the expression level of a gene in an allotetraploid is not equal to the sum of two parental loci (1 + 1 ≠ 2),leading to activation (>2), repression (<2), dominance, or overdominance 15. Many genes in energy and metabolism including photosynthesis and starch pathways are upregulated 1,coinciding with growth vigor in the allotetraploids. This morphological vigor is commonly observed 17, and phenotypic variation among allotetraploids are related to genetic and epigenetic mechanisms 15.Among 128 genes upregulated in the allotetraploids, 86 (～67%) each contains at least one CBS (AAAAATCT) or evening element (EE, AAAATATCT)13 within the ～1,500-kbp upstream region (Supplementary Table 1), which is significantly higher than all genes containing putative EE and CBS (～15%, χ2 = 157 and P ≤ 2.2e ?16). These EE- and CBS-containing genes are likely the targets of CCA1 and LHY 9,18,https://www.360docs.net/doc/fb3560654.html,A1 and LHY are MYB-domain transcription factors and have partially redundant but

incompletely overlapping functions 9,10. They negatively regulate TOC1 and GI expression,

whereas TOC1 and GI positively regulate CCA1 and LHY expression 10,11,12. This circular

feedback regulation affects central oscillation as well as input and output pathways that

maintain the rhythms, amplitude and/or phase of circadian clock in Arabidopsis 20. Disrupting

oscillator control alters the expression of ～10% Arabidopsis genes 13, while maintaining

circadian clock regulation increases CO 2 fixation, growth, and fitness 5,8.

We found that CCA1 and LHY were repressed, and TOC1 and GI were upregulated at noon in

the allotetraploids 1. As in the parents, both CCA1 and LHY displayed diurnal expression

patterns in the allotetraploids (Fig. 1a and Supplementary Fig. 2a and Table 2). Their expression

peaked at dawn (ZT0), decreased 6 hours after dawn (ZT6), and continued declining until dusk

(ZT15). Interestingly, CCA1 and LHY were expressed 2?4-fold lower in the allotetraploids

than the mid-parent value (MPV) at ZT6?12 and higher than the MPV at dusk (ZT15).

TOC1 and GI expression was inversely correlated with CCA1 and LHY expression (Fig. 1b

and Supplementary Fig. 2b), suggesting feedback regulation in the allotetraploids as in the

diploids 10,11,12. However, TOC1 and GI expression fluctuated in the allotetraploids, indicating that other factors may be involved 20. The expression changes of these genes from noon to dusk

in the allotetraploids may alter the amplitude but not the phase of circadian clock, as they

quickly gained the expression levels similar to MPV after dusk (ZT18?24).

To determine how CCA1 and LHY expression was repressed, we examined expression patterns

of A. thaliana and A. arenosa loci in the allotetraploids using RT-PCR and cleaved amplified

polymorphic sequence (CAPS) analyses 1 that are discriminative of locus-specific expression

patterns (Supplementary Table 3). While A. thaliana and A. arenosa loci were equally

NIH-PA Author Manuscript

expressed in respective parents, in two allotetraploids A. thaliana CCA1 (AtCCA1) expression was down-regulated ～3-fold, and A. arenosa CCA1 (AaCCA1) expression was slightly reduced (Fig. 1c). Similarly, AtLHY expression was dramatically reduced (～3.3-fold), whereas AaLHY expression was decreased ～2-fold in the allotetraploids. Conversely, AtTOC1 and AtGI loci were upregulated in the allotetraploids. The data suggest that A. thaliana genes are more sensitive to expression changes in the allotetraploids probably through cis - and trans -acting effects and chromatin modifications as observed in other loci 17.We examined chromatin changes in the upstream regions (～250-bp) of CCA1, LHY , TOC1,and GI (Supplementary Table 4) using antibodies against histone H3-Lys9 acetylation (H3K9Ac) and H3-Lys4 dimethylation (H3K4Me2), two marks for gene activation 21. H3K9Ac and H3K4Me2 levels in the CCA1 and LHY promoters were 2?3-fold lower in the allotetraploids than that in A. thaliana and A. arenosa (Fig. 1d), consistent with CCA1 and LHY repression. Likewise, TOC1 and GI upregulation correlated with increased levels of H3K9Ac and H3K4Me2. Changes in H3K9Me2, a heterochromatic mark 21, were undetectable (data not shown). These data suggest that diurnal expression changes of LHY , CCA1, TOC1,and GI are associated with euchromatic histone marks. Alternatively, autonomous pathways and other factors such as ELF4 may mediate TOC1 and GI expression 20,22.To test downstream effects of CCA1 and LHY repression, we examined expression of two subsets of EE/CBS-containing genes (Fig. 2a). One subset consists of the genes encoding protochlorophyllide (pchlide) oxidoreductases a and b, PORA and PORB , that mediate the only light-requiring step in chlorophyll biosynthesis in higher plants 23. PORA and PORB are strongly expressed in seedlings and young leaves, and upregulation of PORA and PORB increases chlorophyll a and b content 24. Both PORA and PORB were upregulated in the allotetraploids (Fig. 2d). The total chlorophyll content in both allotetraploids was ～60% higher than in A. thaliana and ～15% higher than in A. arenosa (Fig. 2b). Chlorophyll a increased more than chlorophyll b, and the allotetraploids accumulated ～70% more chlorophyll a than A.

thaliana .

The other subset of EE/CBS-containing genes encodes enzymes in starch metabolism and sugar

transport 25,26, many of which show strong diurnal rhythmic expression patterns 13,27. Starch

metabolism involves the genes encoding AMY3, BAM1, 2 and 3, DPE1 and 2, GTR, GWD1

and 3, ISA1, 2 and 3, LDA, MEX1, and PHS1 and 225,26 (Fig. 2c and Supplementary Table

5). Many contained EE/CBS (Fig. 2a) and were upregulated 1.5?4-fold in the allotetraploids

(Fig. 2e), when CCA1 and LHY were down-regulated (Fig. 1, a and c). MTR and BAM3, 4

lacking EE/CBS showed little expression changes, suggesting that their expression is

independent of clock regulation or undergoes post-transcriptional regulation 26.

As a result, allotetraploids accumulated more starch than the parents in both mature and

immature leaves using iodine-staining (Fig. 3a) and quantitative assays (Fig. 3b). In the mature

leaves, allotetraploids accumulated starch 2-fold higher than A. thaliana and 70% higher than

A. arenosa . In the immature leaves, allotetraploids contained 4-fold higher starch than A.

thaliana and 50?100% higher sugar content than the parents (Fig. 3c), mainly due to increases

in glucose and fructose content, suggesting high rates of starch and sugar accumulation in

young leaves. The sucrose content in allotetraploids was similar to A. arenosa but higher than

in A. thaliana in immature leaves and similar among all lines tested in mature leaves (data not

shown), indicating rapid transport and metabolism of sucrose especially in the mature leaves.

Together, chlorophyll, starch, and sugar amounts were consistently high in the allotetraploids.

We further tested if circadian clock regulation is altered in F 1 hybrids as in the interspecific

hybrids and alloptetraploids. At ZT6 (noon), CCA1 and LHY were repressed ～2-fold, whereas

TOC1 was upregulated ～2-fold in the F 1 hybrids relative to the parents (C24 and Columbia)

NIH-PA Author Manuscript

(Supplementary Fig. 3). At ZT15, CCA1 and LHY were upregulated, whereas TOC1 was repressed in the hybrids. The F 1 hybrids displayed morphological vigor (Fig. 3d) and contained ～12% more total chlorophylls and ～10% more starch than the higher parent (Fig. 3e).To determine how CCA1 regulates downstream genes and output traits, we examined CCA1function in the allotetraploids and their parents. CCA1 protein levels in these lines were high at dawn (ZT0) and low at noon (ZT6) (Fig. 3f), corresponding to the CCA1 transcript levels (Fig. 1a). CCA1 levels were constantly high in A. thaliana constitutive CCA1-overexpression (CCA1-OX) lines 18. Electrophoretic mobility shift assay (EMSA) indicated specific binding of recombinant CCA1 to EE-containing fragments of the target genes TOC1, PORB , PORA ,DPE1, and GWD3 (Fig. 3g , Supplementary Fig. 4 and Table 6). Using antibodies against CCA1in chromatin immunoprecipitation (ChIP) assays 17, we further demonstrated that endogenous CCA1 in the TOC1 promoter was ～2.5-fold lower at ZT6 (noon) than at ZT0 (dawn) (Fig. 3h),which is inversely correlated with TOC1 expression levels that were higher at noon than at dawn (Fig. 1b).These data collectively suggest that CCA1 directly affects TOC1 and downstream genes in clock regulation, photosynthesis, and starch metabolism. Clock dependent upregulation of output genes 13,27 may lead to growth vigor. Indeed, overexpressing PORA and PORB increases chlorophyll content, seedling viability, and growth vigor in A. thaliana 24, while mutants of starch metabolic genes display reduced starch content and growth vigor (ref.26).If CCA1 repression promotes growth, CCA1 overexpression would reduce growth vigor in diploids. Indeed, TOC1:CCA1 transgenic plants expressing CCA1 under the clock-regulated TOC1 promoter (Supplemental Fig. 5) displayed 3-fold induction of CCA1 expression at noon (Fig. 4a) and 1.5?30-fold repression of the downstream genes PORA , PORB , AMY , DPE1, and GWD (Supplementary Fig. 6a), resulting in ～14% and ～17% reduction of chlorophyll and starch contents, respectively (Fig. 4a). CCA1-OX had ～20% reduction of chlorophyll content in seedlings (Supplementary Fig. 5c) and may affect various regulators in clock and other

pathways related to growth vigor. For example, gi mutants in A. thaliana increase starch content and flower late 28, but GI induction in the allotetraploids correlates with starch accumulation.

CCA1-OX lines also flowered late 18 and may increase chlorophyll and starch content in late

stages.

To test whether CCA1 repression has positive effects on growth vigor in diploids as in the

hybrids and allotetraploids (Fig. 2b and Fig. 3, a-e), we examined starch content in cca1 single

and cca1 lhy double mutants 9,22,29. CCA1 expression was not completely abolished in these

mutants (Fig. 4b) probably because of the T-DNA insertion near the ATG codon 29. The five

downstream genes examined were upregulated 1.5?12.5-fold in the mutants (Supplementary

Fig. 6b), and the starch content was doubled in the cca1 mutant (Fig. 4b). The starch content

was lower in the double mutant than in cca1, indicating a metabolic penalty of severely lacking

clock regulation 5. Furthermore, to reduce CCA1 expression during the day, we expressed

cca1-RNAi driven by the TOC1 promoter (Supplementary Fig. 6c). In the TOC1:cca1-RNAi

transgenic plants, CCA1 mRNA and protein levels were down-regulated 2?10 fold (Fig. 4c,

left) and 1.4?3 fold (right), respectively. Consequently, four downstream genes examined were

upregulated in the TOC1:cca1-RNAi lines (Supplementary Fig. 6e), and the starch content

increased ～28% (Fig. 4d). Taken together, the data suggest a mechanistic role of CCA1

repression in promoting downstream pathways, increasing chlorophyll and starch

accumulation and growth vigor.

We propose a model that explains growth vigor and increased biomass in allotetraploids and

hybrids (Fig. 4e). Correct circadian regulation enhances fitness and metabolism 5,6,8. In the

allotetraploids the expression of clock regulators is altered through autonomous regulation 20

NIH-PA Author Manuscript

and chromatin modifications (Fig. 1d)15, including rhythmic changes in H3 acetylation in the

TOC1 promoter 30. During the day, A. thaliana CCA1 (and LHY ) is epigenetically repressed,

leading to upregulation of EE- and CBS-containing downstream genes in photosynthesis and

carbohydrate metabolism. As a result, the entire network is reset at a high amplitude during

the day, increasing chlorophyll synthesis and starch metabolism. At night CCA1 is derepressed

and resumes normal oscillation. Although little is known about why the A. thaliana genes are

repressed during the day 15, the repression is likely associated with cis - and trans -acting effects

on homoeologous loci in the allotetraploids, as observed in flowering-time genes 17.

Interestingly, modulation of circadian clock regulators in allopolyploids and hybrids is

reminiscent of switching gene expression during dawn- and evening-phased rhythmic

alternation 13,20 that is required for properly maintaining homoeostasis in clock-mediated

metabolic pathways in diploids 9,19. Hybrids and allopolyploids simply exploit epigenetic

modulation of parental alleles and homoeologous loci of the internal clock regulators and use

this convenient mechanism to alter the amplitude of gene expression and metabolic flux and

gain advantages from clock-mediated photosynthesis and carbohydrate metabolism.

Epigenetic regulation of a few regulatory genes induces cascade changes in downstream genes

and physiological pathways and ultimately growth and development, which provides a general

mechanism for growth vigor and increased biomass 2,3,15 that are commonly observed in the

hybrids and allopolyploids produced within and between species.METHODS SUMMARY Allotetraploids were resynthesized as previously described 1,4, and hybrids were made by crossing C24 with Columbia. Unless noted otherwise, 8?15 plants (grown under 22°C and 16-hour light/day) from each of 2?3 biological replications were pooled for the analysis of DNA,RNA, protein, chlorophyll, starch, and sugar. TOC1:CCA1 and TOC1:cca1-RNAi transgenic plants were produced using pEarlygate303 (CD694) and pCAMBIA (CD3?447) derivatives,respectively. cca1?11 (CS9378) and ccal-11 lhy-21 (CS9380) mutants 9,22,29 were obtained

from ABRC. Protein blot, EMSA, and ChIP assays were performed as previously

described 17,18.

Full Methods and any associated references are available in the online version of the paper at

https://www.360docs.net/doc/fb3560654.html,/nature.

METHODS

Plant Growth

Plant materials included A. thaliana autotetraploid (At4, ABRC accession#CS3900), A.

arenosa (Aa, CS3901), and two independently resynthesized allotetraploid lineages (Allo733

and Allo738) (CS3895?96) (F 7 to F 8). All plant materials were generated as previously

described 1,4. Plants for 24-hour rhythm analysis were grown for 4 weeks in 16/8-hr (light/dark)

cycles and harvested at indicated zeitgeber time (ZT0 = dawn)20. For each genotype, mature

leaves from five plants were harvested every 3 hrs for a period of 48 hrs and frozen in liquid

nitrogen. The data from the first 24-hr period were shown because the second-period data were

the same. Leaves were collected prior to bolting (6?8 rosette leaves in A. thaliana , 10?12 leaves

in A. arenosa , and 12?15 leaves in allotetraploids) to minimize developmental variation among

genotypes 31,32. Unless noted otherwise, analyses for gene expression, chlorophyll, starch, and

sugars were performed at ZT6 (noon), 6, 9, and 15.

CCA1 transgenic plants

The constitutive CCA1-overexpression line (CCA1-OX) was kindly provided by Elaine Tobin

at University of California, Los Angels. We amplified a TOC1 (At5g61380.1) promoter

NIH-PA Author Manuscript

fragment using A. thaliana Columbia genomic DNA and the primer pair 5’-GGGAATTCCGTGTCTTACGGTGGATGAAGTTGA-3’ (Eco RI) and 5’-GGGGATCCGTTTTGTCAATCAATGGTCAAATTATGAGACGCG-3’ (Bam HI) and a

full-length CCA1 cDNA fragment using the primer pair: 5’-GCGGCCGGATCCATGGAGACAAATTCGTCTGG AG-3’ (Bam HI) and 5’-GGCCGCTCTAGATCATGTGGAAGCTTGAGTTTC-3’ (Xba I). The TOC1 promoter

fragment was fused to CCA1 cDNA and cloned into pBlueScript. The inserts were validated

by sequencing and subcloned into pEarlyGate303 (CD694) using the primer pair 5’-

GGGGACAAGTTTGTACAAAA

AAGCAGGCTTACGTGTCTTACGGTGGATGAAGTTGA -3’ and 5-

GGGGACCACTTTGTACAAGAAAGCTGGGTCTGTGGAAGCTTGAGTTTCCAACCG

-3’. The construct (ProTOC1:CCA1) was transformed into A. thaliana (Columbia) plants 33

(Supplementary Fig. 4b). One-week old T1 seedlings (two true leaves) were sprayed with basta

solution (～100 mg/L), and the positive plants were genotyped (Supplementary Fig. 4). T2

transgenic plants (TOC1:CCA1) were subjected to chlorophyll, starch, and gene expression

analysis.

To make the TOC1:cca1-RNAi construct, we amplified a TOC1 promoter fragment

(ProTOC1) using the primer pair: F-EcoRI-ProTOC1 5'-GGGAATTCCGTGTCTTACGGTGGATGAAGTTGA-3' and R-ProTOC1-NcoI 5'-GCGGCCCCATGGGTTTTGTCAATCAATGGTCAAATTATGAGACGCG-3' and

replaced 35S promoter with ProTOC1 in pFGC5941 (CD3?447) (Supplementary Fig. 5c). A

250-bp CCA1 fragment was amplified using the primer pair: F-RNAi CCA1 Xba I Asc I 5’-GCGGCCTCTAGAGGCGCGCCTCTGGAAAACGGTAATGAGCAAGGA-3’ and R-

RNAi CCA1 Bam HI Swa I 5’-GGCCGCCCTAGGTAAATTTACACCACTAGAATCGGGAGGCCAAA-3’. We

subcloned the Bam HI-Xba I fragment and then the Asc I-Swa I fragment into the same vector,

generating two CCA1 fragments in opposite orientations (pTOC1:cca1-RNAi)

(Supplementary Fig. 5c). Four TOC1:cca1-RNAi T1 transgenic plants were used to analyze

gene expression and starch content.

We obtained mutant seeds of cca1?11 (CS9378) and cca1?11 lhy-21 (CS9380)22,29 from

ABRC. Gene expression, chlorophyll and starch assays were performed when the mutant plants

were about 3?4 weeks old and had 6?8 true leaves under 16/8 hours of day/night before

bolting 9.

Note that CCA1-OX and TOC1:CCA1 lines flowered late (Supplementary Fig. 4)18, whereas

cca1 and cca1/lhy mutants flowered early 9,29. A few TOC1:cca1-RNAi lines flowered early,

whereas some flowered late (Supplementary Fig. 5d), which may be related to various

secondary and systematic effects on the downstream genes related to flowering time. All assays

in mutant and transgenic plants were performed before bolting.

DNA and RNA Analysis

Genomic DNA was extracted using a modified protocol 32. Total RNA was extracted using

RNeasy plantmini kits (Qiagen, Valencia, CA). The first-strand cDNA synthesis was

performed using reverse transcriptase (RT) Superscript II (Invitrogen, Carlsbad, CA). An

aliquot (1/100) of cDNA was used for quantitative RT-PCR (qRT-PCR) analysis using the

primer pairs for LHY , CCA1, TOC1, and GI (Supplementary Table 2) in an ABI7500 machine

(Applied Biosystems, Foster City, CA) as previously described 34, except that ACT2 was used

as a control to estimate the relative expression levels (R.E.L.) in three biological replications.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

To distinguish locus-specific expression patterns, the RT-PCR products were amplified using

the primer pairs (Supplementary Table 3) and subjected to cleaved amplified polymorphism

sequence (CAPS) analysis 32.

Semi-quantitative RT-PCR was used to determine the expression levels of the genes in

chlorophyll a and b biosynthesis and starch metabolism (Supplementary Table 5).

Chlorophyll, starch and sugar contents

Chlorophyll was extracted in dark with 5 ml of acetone (80%) at 4°C from 300 mg 4-week-

old seedlings. The chlorophyll content was calculated using spectrophotometric measurements

at light wavelengths of 603, 645 and 663 nm and 80% acetone as a control 35 and shown as

milligram of chlorophyll per gram of fresh leaves.Starch content was measured from leaves of five plants (about 600 mg fresh weight). The leaves were boiled in 25 mL 80% (v/v) ethanol. The decolored leaves were stained in an iodine solution or ground with a mortar and pestle in 80% ethanol 36,37. Total starch in each sample was quantified using 30 μL of the insoluble carbohydrate fraction using a kit from Boehringer Mannheim (R-Biopharm, Darmstadt, Germany).

To quantify soluble sugars, 600 mg fresh leaves were extracted with 80% ethanol according

to a published protocol 38. The sugar concentration was determined enzymatically using

Maltose/Sucrose/D-Glucose and D-Glucose/D-Fructose kits, respectively (Boehringer

Mannheim, R-Biopharm) and shown as milligram of sugar per gram of fresh leaves.

Promoter motif analysis

DNA sequences from ～1,500-bp upstream of the transcription start sites of the upregulated

genes identified in the allotetraploids 1 were extracted and searched for evening element (EE,

AAAATATCT) or CCA1 binding site (CBS, AAAAATCT)10,18,39. The same method was

used to analyze motifs in all genes in Arabidopsis genome 40. The list of 128 upregulated genes

and motif locations is provided in Supplementary Table 1.

Chromatin immunoprecipitation (ChIP)

The ChIP assays were performed using a modified protocol 41,42. We used 1/10 of chromatin

solution as input DNA to determine DNA fragment sizes (0.3?1.0-kbp). The remaining

chromatin solution was diluted 10-fold and divided into two aliquots; one was incubated with

10 μl of antibodies (anti-dimethyl-H3-Lys4, anti-dimethyl-H3-Lys9, anti-acetyl-H3-Lys9, all

from Upstate Biotechnology, NY; or anti-CCA1), and the other incubated with protein beads.

The immunoprecipitated DNA was amplified by semi-quantitative PCR using the primers

designed from the conserved sequences of the CCA1, LHY , TOC1, and GI upstream of the

ATG codon from both A. thaliana and A. arenosa loci (Supplementary Table 4). Two

independent experiments were performed and analyzed.

NIH-PA Author Manuscript

Electrophoretic mobility shift assay (EMSA)

A CCA1 full-length cDNA was amplified from A. thaliana cDNA using a primer pair ATTB1_CCA1_F_XHO: 5’-

GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCTCGAGATGGAGACAAATTCGT CT-3’ and CCA1-R-Avr2-AttB2: 5’-

GGGGACCACTTTGTACAAGAAAGCTGGGTCCCCTAGGTCATGTGGAAGCTTGAG

TTTC-3’. The cDNA was cloned into pDONR221 and validated by sequencing. The resulting

insert was transferred by recombination into pET300/NT-DEST expression vector (Invitrogen

Corp., Carlsbad, CA) and expressed in Escherichia coli Rosetta-gami B competent cells

(Novagen, Madison, WI). Recombinant CCA1 protein was purified and subjected to

EMSA 39 in 6% native polyacrylamide gels using rCCA1 (10 fmoles) and 32P-labeled double-

stranded oligonucleotides (10 fmoles, Supplementary Table 6). The cold probe (Cp)

concentrations were 0 (?), 50 (5×), 100 (10×), 200 (20×), and 500 (50×) fmoles, respectively.

Western blot analysis

Protein crude extracts were prepared from fresh leaves as previously described 18. The

immunoblots were probed with anti-CCA1, and antibody binding was detected by ECL

(Amersham, Piscataway, NJ).Supplementary Material Refer to Web version on PubMed Central for supplementary material.Acknowledgements We are indebted to Elaine Tobin for her generous gifts of the CCA1-overexpression line and antibodies against CCA1.We thank Helen Y. Chen for advice on recombinant CCA1 production, Danny Wang Ng for Western blot analysis,Thomas Juenger for insightful discussions on life history traits in Arabidopsis, and Daniel Chen and Enamul Huq for

careful readings of the manuscript. We thank anonymous reviewers for their constructive and insightful comments on

performing critical experiments to improve the manuscript. The work is supported by the grants from the National

Science Foundation Plant Genome Research Program (DBI0733857 and DBI0624077) and the National Institutes of

Health (GM067015) (Z.J.C.) and National Basic Research Program of China (2007CB109000) (Q.S.).

References

1. Wang J, et al. Genomewide nonadditive gene regulation in Arabidopsis allotetraploids. Genetics

2006;172:507–517. [PubMed: 16172500]

2. Lippman ZB, Zamir D. Heterosis: revisiting the magic. Trends Genet 2007;23:60–66. [PubMed:

17188398]

3. Birchler JA, Auger DL, Riddle NC. In search of the molecular basis of heterosis. Plant Cell

2003;15:2236–2239. [PubMed: 14523245]

4. Comai L, et al. Phenotypic instability and rapid gene silencing in newly formed Arabidopsis

allotetraploids. Plant Cell 2000;12:1551–1568. [PubMed: 11006331]

5. Dodd AN, et al. Plant circadian clocks increase photosynthesis, growth, survival, and competitive

advantage. Science 2005;309:630–633. [PubMed: 16040710]

6. Wijnen H, Young MW. Interplay of circadian clocks and metabolic rhythms. Annu Rev Genet

2006;40:409–448. [PubMed: 17094740]

7. Panda S, Hogenesch JB, Kay SA. Circadian rhythms from flies to human. Nature 2002;417:329–335.

[PubMed: 12015613]

8. Michael TP, et al. Enhanced fitness conferred by naturally occurring variation in the circadian clock.

Science 2003;302:1049–1053. [PubMed: 14605371]

9. Mizoguchi T, et al. LHY and CCA1 are partially redundant genes required to maintain circadian

rhythms in Arabidopsis. Dev Cell 2002;2:629–641. [PubMed: 12015970]

NIH-PA Author Manuscript

10. Alabadi D, et al. Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock. Science 2001;293:880–883. [PubMed: 11486091]11. Strayer C, et al. Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science 2000;289:768–771. [PubMed: 10926537]12. Park DH, et al. Control of circadian rhythms and photoperiodic flowering by the Arabidopsis GIGANTEA gene. Science 1999;285:1579–1582. [PubMed: 10477524]13. Harmer SL, et al. Orchestrated transcription of key pathways in Arabidopsis by the circadian clock.Science 2000;290:2110–2113. [PubMed: 11118138]14. Leitch AR, Leitch IJ. Genomic plasticity and the diversity of polyploid plants. Science 2008;320:481–483. [PubMed: 18436776]15. Chen ZJ. Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. Annu Rev Plant Biol 2007;58:377–406. [PubMed: 17280525]16. Rieseberg LH, Willis JH. Plant speciation. Science 2007;317:910–914. [PubMed: 17702935]17. Wang J, Tian L, Lee HS, Chen ZJ. Nonadditive Regulation of FRI and FLC Loci Mediates Flowering-Time Variation in Arabidopsis Allopolyploids. Genetics 2006;173:965–974. [PubMed: 16547097]18. Wang ZY, Tobin EM. Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1(CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell 1998;93:1207–1217. [PubMed: 9657153]19. Alabadi D, Yanovsky MJ, Mas P, Harmer SL, Kay SA. Critical role for CCA1 and LHY in maintaining circadian rhythmicity in Arabidopsis. Curr Biol 2002;12:757–761. [PubMed: 12007421]20. McClung CR. Plant circadian rhythms. Plant Cell 2006;18:792–803. [PubMed: 16595397]21. Jenuwein T, Allis CD. Translating the histone code. Science 2001;293:1074–1080. [PubMed:11498575]22. Doyle MR, et al. The ELF4 gene controls circadian rhythms and flowering time in Arabidopsis thaliana. Nature 2002;419:74–77. [PubMed: 12214234]23. Reinbothe S, Reinbothe C, Lebedev N, Apel K. PORA and PORB, Two Light-Dependent Protochlorophyllide-Reducing Enzymes of Angiosperm Chlorophyll Biosynthesis. Plant Cell 1996;8:763–769. [PubMed: 12239398]

24. Sperling U, van Cleve B, Frick G, Apel K, Armstrong GA. Overexpression of light-dependent PORA

or PORB in plants depleted of endogenous POR by far-red light enhances seedling survival in white

light and protects against photooxidative damage. Plant J 1997;12:649–658. [PubMed: 9351249]

25. Lloyd JR, Kossmann J, Ritte G. Leaf starch degradation comes out of the shadows. Trends Plant Sci

2005;10:130–137. [PubMed: 15749471]

26. Smith AM, Zeeman SC, Smith SM. Starch degradation. Annu Rev Plant Biol 2005;56:73–98.

[PubMed: 15862090]

27. Smith SM, et al. Diurnal changes in the transcriptome encoding enzymes of starch metabolism provide

evidence for both transcriptional and posttranscriptional regulation of starch metabolism in

Arabidopsis leaves. Plant Physiol 2004;136:2687–2699. [PubMed: 15347792]

28. Eimert K, Wang SM, Lue WI, Chen J. Monogenic Recessive Mutations Causing Both Late Floral

Initiation and Excess Starch Accumulation in Arabidopsis. Plant Cell 1995;7:1703–1712. [PubMed:

12242359]

29. Hall A, et al. The TIME FOR COFFEE gene maintains the amplitude and timing of Arabidopsis

circadian clocks. Plant Cell 2003;15:2719–2729. [PubMed: 14555691]

30. Perales M, Mas P. A functional link between rhythmic changes in chromatin structure and the

Arabidopsis biological clock. Plant Cell 2007;19:2111–2123. [PubMed: 17616736]

31. Madlung A, et al. Remodeling of DNA methylation and phenotypic and transcriptional changes in

synthetic Arabidopsis allotetraploids . Plant Physiol 2002;129:733–746. [PubMed: 12068115]

32. Wang J, et al. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids.

Genetics 2004;167:1961–1973. [PubMed: 15342533]

33. Clough SJ, Bent AF. Floral dip: a simlified method for Agrobacterium-mediated transformation of

Arabidopsis thaliana. Plant J 1998;16:735–743. [PubMed: 10069079]

NIH-PA Author Manuscript

34. Lee HS, et al. Sensitivity of 70-mer oligonucleotides and cDNAs for microarray analysis of gene expression in Arabidopsis and its related species. Plant Biotechnology Journal 2004;2:45–57.[PubMed: 17166142]35. Mochizuki N, Brusslan JA, Larkin R, Nagatani A, Chory J. Arabidopsis genomes uncoupled 5(GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proc Natl Acad Sci U S A 2001;98:2053–2058. [PubMed: 11172074]36. Yu TS, et al. The Arabidopsis sex1 mutant is defective in the R1 protein, a general regulator of starch degradation in plants, and not in the chloroplast hexose transporter. Plant Cell 2001;13:1907–1918.[PubMed: 11487701]37. Smith AM, Zeeman SC. Quantification of starch in plant tissues. Nat Protoc 2006;1:1342–1345.[PubMed: 17406420]38. Focks N, Benning C. wrinkled1: A novel, low-seed-oil mutant of Arabidopsis with a deficiency in the seed-specific regulation of carbohydrate metabolism. Plant Physiol 1998;118:91–101. [PubMed:9733529]39. Harmer SL, Kay SA. Positive and negative factors confer phase-specific circadian regulation of transcription in Arabidopsis. Plant Cell 2005;17:1926–1940. [PubMed: 15923346]40. Arabidopsis Genome Initiative. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana . Nature 2000;408:796–815. [PubMed: 11130711]41. Bastow R, et al. Vernalization requires epigenetic silencing of FLC by histone methylation. Nature 2004;427:164–167. [PubMed: 14712277]42. Tian L, et al. Reversible histone acetylation and deacetylation mediate genome-wide, promoter-dependent and locus-specific changes in gene expression during plant development. Genetics 2005;169:337–345. [PubMed: 15371352]

NIH-PA Author Manuscript

Figure 1.

Locus-specific and chromatin regulation of circadian clock genes in the allotetraploids. a . qRT-

PCR analysis of CCA1 expression (n = 3, ACT2 as a control) in a 24-hour period (light/dark

cycles) starting from dawn (ZT0, 6 am) (arrows indicate up- and down-regulation,

respectively). b . qRT-PCR analysis of TOC1 expression (n = 3). c . Repression of A. thaliana

CCA1 and LHY and upregulation of A. thaliana TOC1 and GI in the allotetraploids. RT-PCR

products were digested with Ava II (CCA1), Afl III (LHY ), Ssp I (TOC1), and Spe I (GI ). d . ChIP

analysis of CCA1, LHY , TOC1, and GI using antibodies against H3K9Ac and H3K4Me2 (n =

2). –Ab: no antibodies.NIH-PA Author Manuscript

NIH-PA Author Manuscript

Figure 2.

Increase in chlorophyll content and upregulation of the genes involved in chlorophyll and starch

biosynthesis in allotetraploids. a . Locations of CCA1 binding site (CBS) or evening element

(EE) in the downstream genes (Supplementary Table 1). Lower-case letter: nucleotide

variation. b . Increase of chlorophyll (a, b, and total) content in the allotetraploids (n = 3). c .

Starch metabolic pathways (modified from that of 26) in the chloroplast (circled) and cytoplasm.

d . Upregulation of PORA and PORB in th

e allotetraploids at ZT6 (n = 2). gDNA: Genomic

PCR. e . Upregulation of starch metabolic genes in allotetraploids (n = 2) at ZT6. See

Supplementary Table 5 for gene names.

NIH-PA Author Manuscript

Figure 3.

CCA1 function and increased amounts of chlorophyll, starch and sugar in allotetraploids and

F 1 hybrids. a . Starch staining in A. thaliana (At4), A. arenosa (Aa), and allotetraploid (Allo733)

at ZT0, ZT6, and ZT15. b . Increased starch content in allotetraploids at ZT6. c . Increased sugar

content in allotetraploids at ZT6. d . Morphological vigor in F 1 hybrids between A. thaliana

Columbia (Col) and C24. e . Increased chlorophyll (ZT6, left) and starch (ZT15, right)

accumulation in F 1. f . CCA1 protein levels changed at ZT6 and ZT0. g . Specific CCA1 binding

activity to EE of downstream genes (TOC1 and PORB ) in vitro . Cp: cold probes; Pb:32P-labeled

EE-containing probes (Supplementary Table 6). h . ChIP assays of endogenous TOC1 binding

to the TOC1 promoter. The levels were normalized using input DNA (n = 2).

NIH-PA Author Manuscript

Figure 4.A role of CCA1 in growth vigor in allotetraploids and hybrids. a . Relative expression levels

(R.E.L.) of CCA1 (ZT6, left) and reduced chlorophyll (ZT9, middle) and starch (ZT15, right)

accumulation in TOC1:CCA1 lines (n = 3) (Supplementary Fig. 4). Col(B): Columbia

transformed with basta gene. b . Reduced CCA1 expression (ZT6, left) and increased starch

content (ZT15, right) in cca1?11 and cca1?11 lhy-21 mutants 9,29 (n = 3). WT: Wassilewskija

(Ws) or Col. c . Decreased expression of CCA1 mRNA (right, n = 3) and protein (right, n = 2)

(ZT0?18, T2) in TOC1:cca1-RNAi transgenic plants. d . Increased starch content in

TOC1:cca1-RNAi lines (ZT15, n = 2). e . A model for growth vigor and increased biomass.

Chromatin-mediated changes in internal clock regulators (e.g., AtCCA1) in allotetraploids lead

to up- and down-regulation (red and black arrows) and normal oscillation (yellow circle) of

gene expression and output traits (photosynthesis, starch and sugar metabolism) at noon (sun)

and dusk (moon).

NIH-PA Author Manuscript