Nitric oxide-induced Arabidopsis

Research

Nitric oxide-induced rapid decrease of abscisic acid concentration is required in breaking seed dormancy in Arabidopsis

Yinggao Liu 1, Lin Shi 1, Nenghui Ye 1, Rui Liu 1, Wensuo Jia 2 and Jianhua Zhang 1

1Department of Biology, Hong Kong Baptist University, Hong Kong, China; 2College of Agriculture and Biotechnology, China Agricultural University,

Beijing, China

Summary

?Nitric oxide (NO) has been reported to be involved in breaking seed dormancy but its mechanism of action is unclear.

?Here, we report that a rapid accumulation of NO induced an equally rapid decrease of abscisic acid (ABA) that is required for this action in Arabidopsis.

?Results of quantitative real-time polymerase chain reaction (QRT-PCR) and Western blotting indicate that the NO-induced ABA decrease correlates with the regulation of CYP707A2 transcription and (+)-abscisic acid 8′-hydroxylase (encoded by CYP707A2) protein expression. By analysing cyp707a1, cyp707a2 and cyp707a3mutants, we found that CYP707A2 plays a major role in ABA catabolism during the first stage of imbibition.

?Fluorescent images demonstrate that NO is released rapidly in the early hours at the endosperm layer during imbibition. Evidently, such response precedes the enhancement of ABA catabolism which is required for subsequent seed germination.

Author for correspondence:Jianhua Zhang

Tel: +852-********

Email: jzhang@https://www.360docs.net/doc/e313039073.html,.hk Received: 6 March 2009Accepted: 19 April 2009

New Phytologist (2009) 183: 1030–1042doi : 10.1111/j.1469-8137.2009.02899.x

Key words:abscisic acid (ABA), CYP707A2, dormancy, germination, nitric oxide (NO), (+)-abscisic acid 8′-hydroxylase.

Introduction

Seed germination is a complex process and incorporates events that commence with the uptake of water by the quiescent dry seed and terminate with the elongation of the embryonic axis (Bewley & Black, 1994; Holdsworth et al .,2008). Seeds of most angiosperms are dormant at maturity and this dormancy must be broken before germination can occur (Bewley, 1997). Seed dormancy has been defined as the incapacity of a viable seed to germinate under favorable external conditions (Finch-Savage & Leubner-Metzger, 2006).It can be explained as coat-imposed dormancy and embryo dormancy. In Arabidopsis it is controlled by both seed coat and embryo (Debeaujon & Koornneef, 2000; Ogawa et al ., 2003;Finch-Savage & Leubner-Metzger, 2006; Müller et al ., 2006).Some environmental factors such as light intensity and low temperatures are known as regulators of seed dormancy (Holdsworth et al ., 2008). Roles of abscisic acid (ABA) and gibberellic acid (GA) in dormancy and germination have been reported by many investigators (Bewley, 1997; Nakajima et al ., 2006; Carrera et al ., 2008; Holdsworth et al ., 2008).Several signaling molecules, such as nitric oxide (NO) and

some reactive oxygen species (ROS), have also been reported to be involved (Batak et al ., 2002; Bethke et al ., 2004, 2006a;Sarath et al ., 2007). Components in the signaling pathway have been identified. For example, the dog1 mutant is com-pletely nondormant and does not show obvious pleiotropic phenotypes, indicating that DOG1 plays a crucial role in dormancy (Bentsink et al ., 2006). The absence of histone H2B monoubiquitination in the Arabidopsis hub1 (rdo4)mutant also reveals a role for chromatin remodeling in seed dormancy (Liu et al ., 2007). However, the detailed mechanisms of dormancy holding and breaking remain unclear but inter-esting research topics.

Abscisic acid plays an important role in a number of physiological processes such as seed maturation, growth and developmental regulations, seed dormancy and adaptation responses to environmental stresses (Zeevaart & Creelman,1988; Hoffmann-Benning & Kende, 1992; Kuwabara et al .,2003; Nambara & Marion-Poll, 2005). In addition, ABA has been shown to be an important positive regulator of both the induction of dormancy during seed maturation and the maintenance of the dormant state in imbibed seeds following shedding (Finkelstein et al ., 2002; Himmelbach et al ., 2003;

Research

1031

Seo et al ., 2000 and 2004). Arabidopsis ABA-deficient mutants,such as aba1, aba2 and aao3, show the absence of primary dormancy in mature seeds (Finkelstein et al ., 2002; Himmelbach et al ., 2003). Some ABA insensitive mutants such as abi1, abi2and abi3 also lack, or have decreased, primary dormancy in mature seeds (Luerssen et al ., 1998; Raz et al ., 2001; Finkelstein et al ., 2002; Himmelbach et al ., 2003; Kushiro et al ., 2004;Nambara & Marion-Poll, 2005). While overexpression of some ABA biosynthesis genes increases seed ABA content and enhances seed dormancy or delays germination (Finkelstein et al ., 2002; Kushiro et al ., 2004; Nambara & Marion-Poll,2005; Holdsworth et al ., 2008), some investigations showed that ABA catabolism also plays a major role in the mainte-nance seed dormancy and in breaking of dormancy. Seeds of mutant cyp707a2, which lack a key enzyme in ABA catabo-lism, (+)-abscisic acid 8′-hydroxylase, accumulate much more ABA and show stronger dormancy during imbibition than the wild type (Kushiro et al ., 2004; Saito et al ., 2004; Okamoto et al .,2006). It is evident that in comparison with the ABA biosyn-thesis process, functions of ABA catabolism in seed dormancy are less well known. This is especially true for the signaling process that regulates ABA catabolism during germination.A growing body of evidence suggests that NO plays an important role as a signaling molecule in plants and animals (Wendehenne et al ., 2001, 2004; Neill et al ., 2002, 2003;Lamattina et al ., 2003; del Rio et al ., 2004; Romero-Puertas et al ., 2004; Delledonne, 2005, Lamotte et al ., 2005). In plants,previous studies showed that NO can be emitted by plant cells (K lepper, 1979) and act as a growth regulator (Beligni &Lamattina, 2000, 2001a,b). Nitric oxide induces seed germi-nation in the condition of replacement of red light (Beligni &Lamattina, 2000), affects growth and development (Durner & K lessig, 1999), increases iron homeostasis (Murgia et al .,2002) and accelerates plant cell senescence (Leshem et al .,1998). Furthermore, NO has been suggested to be involved in resistant responses to drought, salinity, heat stress, diseases,programmed cell death and ultraviolet-B radiation (Delledonne et al ., 2005; Beligni & Lamattina, 2001b; Garcia-Mata &Lamattina, 2001). It has also been demonstrated to act as an antioxidant scavenger in plants (Garcia-Mata & Lamattina,2001). A role of NO role in dormancy break or germination has also been demonstrated in some species such as Arabi-dopsis (Batak et al ., 2002; Bethke et al ., 2004, 2006a,b),barley (Bethke et al ., 2004) and lettuce (Beligni & Lamattina,2000).

The relationship between NO signaling and ABA response has been demonstrated by some investigators (Bright et al .,2006; Sarath et al ., 2007; Zhang et al ., 2007; Neill et al .,2008). For example, ABA-induced guard cell closure needs participation of NO (Durner & Klessig, 1999; Foissner et al .,2000; Desikan et al ., 2002; Neill et al ., 2002, 2008; Bright et al ., 2006). However, the relationship between NO and ABA in seed germination has yet to be established. In this study, we demonstrate that rapidly accumulated NO induces

an equally rapid ABA decrease that is required for the breaking of seed dormancy and germination in Arabidopsis. Such action correlates to the regulation of ABA catabolism since mutant cyp707a2 did not show the response when compared with wild-type seeds. Results of QRT-PCR and west-blotting indicate that the NO-induced ABA decrease correlates with the regulation of CYP707A2 transcription and the ABA 8′-hydroxylase protein expression.

Materials and Methods

Plant materials

The Arabidopsis (Arabidopsis thaliana ) (Col0 and some T-DNA inserted mutants from Col0) plants were grown in a growth chamber with a 16-h photoperiod at a photoflux density of c . 200μmol m ?2s ?1 at a day temperature of 23°C and a night temperature of 20°C. In order to minimize the effect of seed maturation and storage conditions, plants of each genotype tested were grown in different sections of the same pot and seeds were harvested at the same time. Seeds were harvested in bulk 30d after the petals appeared on the first flowers. These seeds maintained stronger dormancy.Only freshly harvested seeds were used to do the examination.The rest of seeds were stored at ?80°C. Dormancy can be maintained for >1yr at ?80°C (Millar et al ., 2006; Fujii et al ., 2007).T-DNA insertion line

The seeds of Arabidopsis thaliana cyp707a1, cyp707a2,cyp707a3 (SALK_069127, SALK_083966, SALK_026545)generated by Salk Institute Genomic Analysis Laboratory (https://www.360docs.net/doc/e313039073.html,/) were obtained from the Arabidopsis Biological Resource Center (ABRC) (Ohio State University,Columbus, OH, USA). The seeds were planted on agar plates containing kanamycin and the kanamycin-resistant plants were transferred to soil. Seeds were harvested separately from individual plants. Subsequently, to confirm the mutant line as homozygous, PCR was performed with the genomic DNA of cyp707a1, cyp707a2, cyp707a3 mutants using gene-specific oligonucleotides: cyp707a1 (LP TAGCCATCAGGACTTT-GAAGC; RP CCAAAACCCAATACGTTCATG); cyp707a2(LP AATCCCAAATATGCCTTAGGC; RP: TATGTGGGGA CTTTGATGGAC); cyp707a3 (LP CGTAAGAATCAAAC-TGTTACATCAG; RP CAGGTTGGTACACCTTCAAAA-TG); and LB primer (GCGTGGACCGCTTGCTGCAACT).Chemical treatments

Sodium nitroprusside (SNP) and SNAP (Sigma-Aldrich)were used as NO donor to release NO steadily and 2-(4-carboxyphenyl)-4,4,5,5-tetramentylimidazoline-1-oxyl-3-oxide (c-PTIO) (Sigma) was used as NO scavenger (Kopyra

Research

1032& Kopyra, 2003; Bright et al ., 2006). Nordihydroguaiaretic acid (NDGA) and diniconazole (Sigma) were used as the inhibitors of 9-cis epoxcartenoid dioxygenase and ABA 8′-hydroxylase, respectively (Han et al ., 2004; Kitahata et al ., 2005).Germination assay

Fifty seeds were placed in 55-mm diameter Petri dishes with three Whatman No.1 filter papers and 2.2ml of sterile double-distilled water or treatment solutions. Plates were then placed in a 21°C growth chamber under continuous light at 100μm m ?2s ?1 for 7d. The seeds were regarded as germi-nation when radicle emerged. Experiments were performed in quadruple for each treatment.Determination of NO

Nitric oxide was detected by the Nitric Oxide (total)Detection Kit (Assay Designs, Ann Arbor, MI, USA). The mechanism of this kit is to transform NO to nitrite, which is then measured (Rockel et al ., 2002). About 0.2g seeds were put into 1.5ml tubes and then with 200μl reaction buffer and 100μl diluted NADH solution added (100μl water was added into a parallel tube as control). Then, 100μl nitrate reductase (NR) was added to samples and 100μl reaction buffer added to the control tubes. Another 400μl reaction buffer without seeds, NADPH and NR acted as blank. The blank, control and sample tubes were mixed well and incubated at 37°C for 30min. After incubation they were centrifuged at 3000g for 1min and 300μl supernatant was transformed to a new tube. The 100μl Griess Reagent I was then added to control, sample and blank tubes and, after being well mixed,100μl Griess Reagent II was added. Mixing was achieved by shaking followed by incubation at 25°C for 10min. The optical density (OD) of samples and controls were measured at 540nm. Each sample OD was marked as ODs and each control OD marked as ODc. The average net OD was then calculated and marked as ODn. Each average Odn =average Ods –average ODc. Each ODn could be calculated from standard curve; 0–100μm sodium nitrate was used as standard for the standard curve. The NO content released equaled the nitrate content.

Laser scanning confocal microscopy

Laser scanning confocal microscopy (LSCM; Zeiss 510) was used to produce a NO image. Measurement of NO was performed with the specific NO dye DAF-FM (4-amino-5-methylamino-2′,7′-difluorofluorescein), using the method as described by Corpas et al . (2004) with slight modifications.Seeds were incubated in loading buffer (0.1m m CaCl 2,10m m KCl, 10m m 2-(N -morpholino) ethanesulfonic acid (MES)–T ris, pH 5.6, and DAF-FM at a final concentration of 10μm ) for 1h in the dark at 25°C, and followed by

washing with loading buffer for 1h. Before detection the testa of seed was removed and the seed was cut along the axis. All images were visualized using LSCM (excitation at 488nm and emission at 535nm). T o enable the comparison of changes in signal intensity, confocal images were taken under identical exposure conditions for all the samples. The experiment was repeated three times for further verification.Extraction and determination of ABA

The method of ABA extraction and determination was modified according to Cheng et al . (2002). Fresh samples c .0.5g were homogenized and extracted in 5ml 80% acetone containing 2,6-di-tert-butyl-4-methylphenol (200mg l ?1) with grinding and incubated at 4°C for 16h. One milliliter of 1m phosphate buffer at pH 8.0 was added to the extract,1ng of (±)-[1,2-13C 2] abscisic acid (from Hangzhou Qirui Biomedical T echnology Co. Ltd (Hangzhou, China) according to Asami et al ., 1999) was added to each sample as internal standard to percentage recovery. After distilling acetone on a rotary evaporator, lipids were removed by partitioning the aqueous concentrate twice with 5ml hexanes. The pH of the aqueous phase was adjusted to 2.5 with 6n HCl and extracted three times with 5ml ethyl acetate. The acidic fraction was dried and dissolved in 1ml methanol, the solution subjected to HPLC on a μBondapak C18 (30×0.78cm column;Waters, Milford, MA, USA). The elution Buffer was 45%methanol containing 1% acetic acid. The ABA was collected from 10.0 to 12.0min. The fractions containing ABA were dried and methylated with diazomethane. The methylated ABA was used for GC-MS analysis.

The GC-MS analysis was performed with a mass spectro-meter (HP5973; Hewlet-Packard) coupled to a gas chromatograph (HP6980; Hewlet-Packard) with a DB-1 capillary column.The injection temperature was set at 250°C, and the inlet pressure was 70kPa. After injection, the oven temperature was maintained at 80°C for 1 min, increased to 290°C at a rate of 20°C min ?1, and then kept at 290°C for 5min. Mass spectra were obtained under the following conditions: electron energy 1.5kV; ion source temperature 250°C; capillary interface temperature 250°C; ion range 50–450 (mass-to-charge ratio).Abscisic acid was analysed by GC-selected ion monitoring MS by monitoring m/z at 192 ((±)-[1,2-13C 2] abscisic acid)and 190 (endogenous ABA).Western-blot analysis

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described by Laemmli (1970).Forty micrograms proteins was solubilized and separated on a 10% (w :v) acrylamide gel. T otal protein (50μg) was separated by 12% SDS-PAGE then transferred to a nitrocellulose membrane, the membrane was blocked for 60min with 5%(w :v) nonfat milk in 0.05% (w :v) T ween 20, 10m m T ris

Research

1033

(pH 8.0) and 150m m NaCl. The antibody (produced in rabbit; AbMART Inc. (Shanghai, China) against ABA 8′-hydroxylase encoded by CYP707A2 was added and incubated at 4°C overnight. After washing, the alkaline horseradish peroxidase (HRP)-coupled secondary antibody was added and incubated at room temperature for 1.5h. The color was developed with a solution containing H 2O 2. The antigen obtained by chemosynthesis, the protein sequence of chemo-synthesis is C-SNFFSSLYADEPALIT-NH 2. This antigen was then used to immunize the rabbit and to obtained specific antibody from it.QRT-PCR analysis

T otal RNA was isolated from seeds or leaves by RNeasy kit (Invitrogen). DNA impurities in the isolated RNA were digested before synthesizing the cDNA by adding DNase (Invitrogen)and incubating for 30min at 37°C. DNase was then inactivated by incubating for 10min at 65°C and removed with the digested DNA after incubation. T wo micrograms of RNA was reversed to cDNA with SuperScriptIII RTS First-Strand cDNA Synthesis Kit (Invitrogen). The cDNA was then diluted for 10 times and 4μl cDNA was used to perform the QRT-PCR. IQ SYBR Green Supermix (Bio-Rad) was used to perform the QRT-PCR.Actin2 acted as the internal standard. The QRT-PCR was executed with iCycle (Bio-Rad). The primers that were used in QRT-PCR were: CYP707A1 (forward TTGGAAAGAGG-AGACTAGAG; reverse GTGAACCACAAAAGAGGAAC);CYP707A2 (forward AAATGGAGTGCACTCATGTC;reverse CCTTCTTCATCTCCAATCAC); CYP707A3 (forward ATTCTTGTCCAGGCAATGAG; reverse ATAGGCAAT-CCATTCTGAGG); CYP707A4 (forward GAAAGGAATA-CAGTACAGTC; reverse GGATTAGATTTGGCTAACTAC),NCED6 (forward TGAGAGACGAAGAGAAAGAC; reverse GTTCCTTCAACTGATTCTCG); AAO3 (forward GAAGG-TCTTGGAAACACGAAGAA; reverse GAAATACACAT-CCCTGGTGT ACAAAAC); Actin2 (forward GTGAA-GGCTGGATTTGCAGGA; reverse AACCTCCGATCC AGACACTGT).

Generation of CPY707A2 overexpressing and complementary plants

Full-length Arabidopsis CPY707A2 cDNA was obtained by using reverse-transcriptase PCR and cloned into pENTR-TOPO cloning vector (Invitrogen) and sequenced. After LR reaction, CPY707A2 cDNA was inserted into pGWB5 vector (a gift from Prof. Liang, Yangzhou University, China) which had 35S promoter, we named this vector pGWB5-CPY707A2.T ransgenic Arabidopsis using cauliflower mosaic virus (CaMV)35S promoter was generated using the floral dipping method (Clough & Bent, 1998) to transfer into Col-0 wild-type plants or CPY707A2 null plants. T ransformed plants were selected by growth on Hygromycin-containing media. Plants of the

second generation after transformation were used for the experiments. Vacant pGWB5 vectors, acting as control, were also transferred into Col-0 wild-type plants or CPY707A2null plants.Accession numbers

Sequence data from the article can be found in the GenBank data libraries or TIGR database (Arabidopsis thaliana Genome Project) under the following accession numbers: CYP707A1,AT4G19230; CYP707A2, AT2G29090; CYP707A3,AT5G45340; CYP707A4, AT3G19270; NCED6, AT3G24220;and AAO3, AT2G27150.

Results

Effect of NO on seed dormancy

Manipulation of NO levels in imbibed seeds regulated seed dormancy (Fig.1).Freshly harvested Arabidopsis seeds (Col0)have strong dormancy as germination rates only reached 37%after 7d of imbibition. When NO concentrations were increased by treating seeds with SNP , which is an NO donor,at concentrations greater than 25μm , seed dormancy was reduced significantly. Furthermore, SNP at 200μm broke the dormancy entirely, with germination levels reaching over 90%after 7d of imbibition (Fig.1a), whereas the effect of SNP could be overridden completely by treatment with 200μm NO scavenger c-PTIO. In contrast to SNP , c-PTIO enhanced seed dormancy and decreased the germination rate of freshly harvested seeds to <10%, though c-PTIO did not inhibit the germination of nondormancy seeds (Fig.1b). As an additional test a second NO donor, SNAP at 100μm was used in the experiment on seeds germination; we found that the effect of SNAP was similar as SNP and its function also could be reversed by c-PTIO (Fig.1c).

As shown in Fig.2a, the release of NO in the imbibed seeds was rapid and significant in the initial hours and reached a peak at 3h before decreasing to low levels after 6h. With the NO-specific dye, the fluorescent image intensity was enhanced for the first 3h of imbibition before decreasing after 6h in Arabidopsis seeds, while c-PTIO treatments reduced fluores-cent intensity (Fig.2b).

Effect of ABA biosynthesis and ABA catabolism on seed dormancy

Seed dormancy could be regulated by the endogenous ABA level (Fig.3). The ABA contents decreased rapidly in the first 12h of imbibition and stayed at a low level throughout the process (Fig.3a). The decrease could be attributed to the ABA 8′-hydroxylation pathway as in other tissues (Cutler, 1999).In Arabidopsis ABA 8′-hydroxylase is encoded by CYP707A gene family (CYP707A1 to CYP707A4). Our results show

Research

1034that their transcription increased during the first 6h of imbibition and decreased to a lower level after 12h. Among them, CYP707A2 transcription was much higher than the others and CYP707A4 transcription was the lowest (Fig.3b).T ranscripts of two ABA biosynthesis genes, AAO3 and NCED6, decreased during the first 6h before increasing slightly thereafter (Fig.3c). When ABA biosynthesis inhibitors NDGA (inhibiting NCED) and ABA catabolism inhibitor diniconazole (inhibiting ABA 8′-hydroxylase) (Creelman et al .,1992; Han et al ., 2004; K itahata et al ., 2005) were used,NDGA did not have any effect on the germination of freshly harvested seeds whereas diniconazole enhanced seed dormancy significantly (Fig.3d). Germination of freshly harvested seeds were shown to be inhibited by diniconazole to <10%,indicating that ABA catabolism was the primary factor that regulates seed dormancy.

Dormancy of knockout, complementary and overexpression lines of the CYP707A family

Freshly harvested seeds of wild type, cyp707a1, cyp707a2 and cyp707a3

mutants were used to test their germination. Insertion

Fig.2Change of nitric oxide (NO) release during imbibition under different treatments. (a) Change of NO release during imbibition under different treatments (WT, water control; SNP , sodium

nitroprusside and c-PTIO). Values are means with SE (n =3). (b) NO fluorescent images of seeds imbibed for a different number of hours. Seeds were imbibed with water (CK) or 200μM c-PTIO and sampled at different times. Sampled seeds without testa were loaded with DAF-FM (4-amino-5-methylamino-2′,7′-difluorofluorescein) and

detected by confocal laser scanning microscopy.

Fig.1Effect of sodium nitroprusside (SNP) on seed germination and dormancy break in Arabidopsis. (a) Effect of different SNP concentrations on seed dormancy break of freshly harvested wild-type seeds. Seeds were imbibed in water or different concentrations of SNP and the germination ratio was counted after 7d. (b) Effect of SNP and c-PTIO on wild-type seed germination and dormancy break. D, Freshly harvested seeds; ND, nondormancy seeds (ND). Data represent means SE of four replicates, each with 50 seeds in (a and b). (c) Effect of SNAP (Sigma-Aldrich) on wild-type seed germination and dormancy break.

Research

1035

lines of these mutants (Fig.4a) are from ABRC, (Alonso et al .,2003) and homozygous lines were selected and analysed after their third generation. As shown in Fig.4b cyp707a1, cyp707a2and cyp707a3 were all homozygous.

The cyp707a1 and cyp707a3 mutants showed similar pheno-type to wild type in freshly harvested or after-ripen seeds (Fig.4c) with the seeds of cyp707a3 mutant having a slightly higher germination rate than the wild type. However, cyp707a2mutant showed a strong dormancy in freshly harvested seeds.Seeds of wild type, cyp707a1 and cyp707a3 mutants had their dormancy entirely broken 18d after ripening, but cyp707a2mutant still maintained strong dormancy until 30d (Fig.

4d).

Fig.3Changes of abscisic acid (ABA)

contents and transcription of ABA catabolism genes (CYP707A1, CYP707A2, CYP707A3, CYP707A4) and ABA biosynthesis genes (NCED6, AAO3) on germination during

imbibition of Arabidopsis seeds. (a) Change of ABA contents during imbibition of Arabidopsis seeds. (b) Change in the

transcript levels of ABA catabolism genes, CYP707A1 to CYP707A4. (c) Change in the transcript levels of ABA biosynthesis genes, AAO3 and NCED6. (d) Germination of freshly harvested seeds of Arabidopsis imbibed with ABA biosynthesis inhibitor,

Nordihydroguaiaretic acid (NDGA) and ABA catabolism inhibitor, diniconazole or with water (WT). Values are means with SE (n =3

for a–d).

Fig.4Phenotypic analysis of the wild-type (WT), cyp707a1, cyp707a2 and cyp707a3 mutants of Arabidopsis. (a) T-DNA insertion lines in the CYP707A family genes.

(b) Transcriptions of CYP707A family genes in WT and different mutants. (c) Germination of freshly harvested seeds in WT and different mutants of Arabidopsis. (d) Germination of after-ripen seeds in WT and different mutants of Arabidopsis. Values are means with SE (n =4 for c and d).

Research

1036The ABA contents of freshly harvested seeds were also measured during imbibition. As shown in Fig.5a,b,d, ABA concentrations decreased rapidly during the first 12h in wild type, cyp707a1 and cyp707a3 mutants, before staying at a low level after that. In comparison, ABA concentrations in cyp707a2mutant decreased at a much slower rate and maintained a relatively high concentration of ABA after 48h imbibition (Fig.5c). This indicates that it is CYP707A2 that played a crucial role in the rapid decrease of ABA during the early stage of imbibition. We also produced a complementary line of cyp707a2 mutant and an overexpression line of CYP707A2(Fig.6). Results indicated that the complementary line showed similar phenotype to wild type but the overexpression line showed lowered dormancy compared with wild type (Fig.6). In addition, the overexpression line also showed a stronger tolerance to ABA during germination (data not shown).

The CYP707A2 gene was involved in NO-induced dormancy break

How the ABA catabolism process was associated with the NO-induced dormancy break is shown in Fig.7. We used the ABA catabolism mutants, cyp707a1, cyp707a2 and cyp707a3and checked the effect of NO on their seed dormancy break.Nitric oxide effectively broke the dormancy of freshly harvested wild type, cyp707a1 and cyp707a3 seeds. With 200μm SNP treatment, >93% germination rate was achieved after 7d of imbibition, and c-PTIO could override the effect of SNP completely (Fig.7a,c). The dormancy of wild type, cyp707a1and cyp707a3 seeds was also enhanced by c-PTIO, reducing their germination rates to <10%. In comparison, SNP treatment did not increase the germination rate of the cyp707a2 mutant substantially, with an increase from only 8% to 16% (Fig.

7a).

Fig.5Changes of abscisic acid (ABA) levels in freshly harvested CYP707A family knock-out lines and wild-type (WT) seeds of Arabidopsis under sodium nitroprusside (SNP) and c-2-phenyl-4,4,5,5-tetramethyl imidazoline-1-oxyl-3-oxide (cPTIO) treatments during imbibition. (a) Changes of ABA levels in freshly harvested WT seeds. (b) Changes of ABA levels in freshly harvested cyp707a1 (707a1) seeds. (c) Changes of ABA levels in freshly harvested cyp707a2 (707a2) seeds. (d) Changes of ABA levels in freshly harvested cyp707a3 (707a3) seeds. Values are means with SE (n =

3 for a–d).

Fig.6Transcriptions and germination of cyp707a2 mutant, cyp707a2 complementary line (cyp707a2-C) and CYP707A2

overexpression line (cyp707a2-OE) in freshly harvested seeds of Arabidopsis. (a) Transcript levels of CYP707A2 in cyp707a2, cyp707a2 complementary line and two CYP707A2 overexpression lines analysed by RT-PCR. (b) The germination of wild type, cyp707a2, cyp707a2 complementary line and two CYP707A2 overexpression lines in freshly harvested seeds. The germination rates were recorded after 7d of imbibition. Values are means with SE (n =4 for b).

Research

1037

These results show that the function of NO in breaking seed dormancy and in germination relied heavily on the presence and function of CYP707A2.

In order to find out how the gene products of CYP707A2are related to the effect of NO, we first used QRT-PCR to determine the changes of CYP707A2 transcript during seed germination. Freshly harvested seeds of the wild type were imbibed by water, SNP and c-PTIO solutions (Fig.7b). For the control treated with water, the transcript of CYP707A2increased after 1h, reached a peak after 6h, before decreasing after 12h, and then showed sign of slight increase up to 48h.If imbibed with SNP , the amount of CYP707A2 transcript increased much more substantially and stayed high during the entire process. However, CYP707A2 transcription did not increase with c-PTIO treatment or SNP added with c-PTIO.As an additional test, a second NO donor, SNAP at 100μm was used in the experiment on CYP707A2 transcription. We found that SNAP also enhanced CYP707A2 transcription and its function could also be reversed by c-PTIO (data not shown).

The CYP707A2 transcript levels in cyp707a1 and cyp707a3mutants exhibited a similar change to that of the wild type when treated with SNP or c-PTIO during imbibition (Fig.7d).The effect of NO on seed dormancy break also needed the participation of ABA 8′-hydroxylase. Western-blot analysis of ABA 8′-hydroxylase, encoded by CYP707A2, was performed during imbibition (Fig.8). Results indicate that the concen-trations of the ABA 8′-hydroxylase protein increased after the

first 6h before decreasing after 12h (Fig.8a). The SNP treat-ments enhanced 8′-hydroxylase protein significantly, while c-PTIO decreased the concentrations of the 8′-hydroxylase protein (Fig.8b,c), confirming the results for the transcrip-tion analysis of CYP707A2

shown in the earlier figure.

Fig.7Effects of CYP707A2 on seed dormancy break in Arabidopsis. (a)

Germination of freshly harvested wild-type (WT) and mutant cyp707a2 seeds imbibed with water, sodium nitroprusside (SNP) and c-2-phenyl-4,4,5,5-tetramethyl imidazoline-1-oxyl-3-oxide (c-PTIO). (b) Changes of CYP707A2 transcripts in freshly harvested WT seeds imbibed with water, SNP and

c-PTIO. (c) Germination of freshly harvested cyp707a1 and cyp707a3 seeds imbibed with water, SNP and c-PTIO. (d) Change of CYP707A2 transcripts in freshly harvested cyp707a1 (A1) and cyp707a3 (A3) seeds imbibed with water, SNP and c-PTIO. Values are means with SE (n =4 for a and c; n =3

for b and d).

Fig.8Western-blot analysis of ABA 8′-hydroxylase expressions in seeds of Arabidopsis during germination when treated with water (CK), sodium nitroprusside (SNP) or c-2-phenyl-4,4,5,5-tetramethyl imidazoline-1-oxyl-3-oxide (c-PTIO). Freshly harvested seeds were germinated under different treatments. Proteins were extracted and separated by sodium dodecyl sulfate–polyacrylamide gel

electrophoresis (SDS-PAGE). The proteins were immunodetected with antibody (produced in rabbit) against ABA 8′-hydroxylase encoded by CYP707A2. Each treatment was immunodetected with antibody. (a) Freshly harvested seeds imbibed with water.

(b) Freshly harvested seeds imbibed with 200μM SNP . (c) Freshly harvested seeds imbibed with 200μM c-PTIO.

Research

1038NO enhanced the tolerance to ABA in wild type,

cyp707a1 and cyp707a3 mutants but not in cyp707a2 mutant during germination

Similar to results reported in earlier studies (Steber et al ., 2001),ABA started to inhibit seed germination of wild type from 0.5μm with the inhibition becoming almost complete by 2μm (Fig.9a). Nitric oxide effectively enhanced tolerance to ABA. With 200μm SNP treatment, the germination rate of wild-type seeds was maintained at 76% under 1μm ABA and at 28% under 2μm ABA. By contrast, c-PTIO increased the sensitivity of wild-type seeds to ABA treatment. When treated with 200μm c-PTIO, only 10% of the wild-type seeds germinated under 1μM ABA, and no seeds germinated under 2μm ABA (Fig.9a). Mutants cyp707a1 and cyp707a3showed similar results (Fig.9b,c), with the cyp707a2 mutant being more sensitive to ABA treatment than the wild type.Under 0.5μm ABA treatment, the germination rate of cyp707a2 decreased to 38% and under 1μm ABA <10%germinated. The SNP treatment did not enhance the tolerance of ABA with cyp707a2 seeds significantly during germination (Fig.9d).

Rapidly accumulated NO at the early stage of imbibition was required for seed dormancy break The above results showed that NO increased rapidly at first 3 h of imbibition and decreased to a lower level after 6 h,Correspondingly, transcription of CYP707A2 increased at the first 6 h and rapidly decreased to a lower level after 12 h (Figs 2a and 7b). So I want to know if rapidly accumulate

NO is essential for the rapidly decreasing ABA and breaking seed dormancy. As shown in Fig. 10A, when imbibed in SNP for more than 3 h, the dormancy of seeds was broken entirely.We also found when imbibed in c-PTIO for more than 3 h seeds dormancy were enhanced. Then we used c-PTIO to scavenge NO for each 3 h in the first 24 h imbibition, results indicated that scavenged NO for 3 h at first 6 h imbibition enhanced the seed dormancy significantly, while scavenged NO for 3 h after 18 h only affected seed dormancy slightly.The results of ABA contents also indicated that scavenged NO for 3 h at first 9 h decreased ABA catabolism significantly but only slightly after 18h (Fig.10b and c).

Discussion

A crucial role of NO in dormancy break or germination has been demonstrated in some plants such as Arabidopsis (Batak et al ., 2002; Bethke et al ., 2004, 2006a,b), barley (Bethke et al ., 2004) and lettuce (Beligni & Lamattina, 2000). Earlier results show that SNP , the NO donor, breaks seed dormancy,while c-PTIO, the NO scavenger, enhances it. Our results confirm this observation and show, in addition, that NO takes part in mediating ABA catabolism, which is crucial in decreasing ABA levels and breaking dormancy. We have also demonstrated that ABA 8′-hydroxylase encoded by CYP707A2is primarily involved in NO-mediated ABA catabolism and breaking seed dormancy in Arabidopsis.

It is well known that the CYP707A family encoding ABA 8′-hydroxylase regulates ABA catabolism (Kushiro et al ., 2004;Nambara & Marion-Poll, 2005; Okamoto et al ., 2006). We observed that CYP707A2

transcription increased rapidly at

Fig.9Nitric oxide (NO) enhanced seed tolerance to abscisic acid (ABA) during germination. Arabidopsis seeds were

imbibed with water, different concentrations of ABA with or without sodium nitroprusside (SNP) and c-2-phenyl-4,4,5,5-tetramethyl imidazoline-1-oxyl-3-oxide (c-PTIO).

Germination was monitored daily. (a) Wild-type nondormancy seeds; (b) cyp707a1 nondormancy seeds; (c) cyp707a3 nondormancy seeds; (d) cyp707a2

nondormancy seeds. Values are means with SE (n =3).

Research

1039

the first stage of imbibition and led to a correspondingly rapid ABA decrease in the seeds of Arabidopsis (Fig.3). When three mutants of the family were used, the cyp707a2 mutant showed stronger dormancy in freshly harvest seeds and needed longer after-ripen time to break dormancy than the cyp707a1 and cyp707a3 mutants that showed a similar phenotype to wild type (Fig.4). When the ABA changes during imbibition were followed, the ABA levels in the cyp707a2 mutant decreased at a slower rate during the early stage and stayed at higher levels after 48h imbibition than those in wild type, cyp707a1 and cyp707a3 mutants (Fig.5). These results indicate that CYP707A2might play a crucial role in the rapid decrease of ABA during the early stage of imbibition. Results also showed that the CYP707A2 gene and the 8′-hydroxylase protein encoded by CYP707A2 rapidly increased in the first 6h of imbibition and decreased after 12h (Figs 3b, 7b, 8a).

The mechanism of NO affecting seed dormancy is not clear so far. In this study we found that NO was involved in seed dormancy and germination by regulating the ABA catab-olism. Our evidence came from NO measurements as well as the use of chemicals that can manipulate the NO concentrations during imbibition. Mutants of ABA catabolism, as well as mutants of NO production, all proved the same conclusion.Results indicated that NO rapidly accumulated in the first 3h and rapid release of NO preceded the transcription of CYP707A2 and ABA 8′-hydroxylase expression encoded by CYP707A2 during imbibition (Figs 2, 7, 8). As a consequence,ABA concentrations decreased and led to the breaking of dormancy (Figs 5, 7). Exogenous NO increased germination of wild type, cyp707a1 and cyp707a3 mutants significantly but not the cyp707a2 mutant (Figs 1, 7). As shown in Fig.5,200m m SNP broke dormancy of freshly harvested seeds of wild type, cyp707a1 and cyp707a3, although the cyp707a1and cyp707a3 mutants had similar higher ABA level when compared with the cyp707a2 mutant (Figs 5, 7). However,200m m SNP did not affect the germination of cyp707a2mutant with freshly harvested seeds (Fig.7a). We also found that cyp707a1 and cyp707a3 mutants had higher transcription of CYP707A2 when compared with the wild type (Fig.7).The speed of ABA catabolism was also enhanced by SNP and inhibited by c-PTIO substantially in WT, cyp707a1and cyp707a3 mutants, while SNP did not enhance the speed of ABA catabolism in cyp707a2 mutant (Fig.5). Sodium nitroprusside enhanced tolerance of wild-type, cyp707a1 and cyp707a3 mutant seeds to ABA but not cyp707a2 (Fig.9).The role of CYP707A2 gene in ABA catabolism and seed dormancy was also confirmed by the complementary line of cyp707a2 mutants which showed similar phenotype to wild type. The seeds of the overexpression line of CYP707A2showed lower dormancy when compared with wild type (Fig.6). Overexpression of CYP707A2 also showed stronger tolerance to ABA during germination (data not shown). These results indicated that the CYP707A2 gene plays a major role

in ABA catabolism during imbibition and the role of NO in

Fig.10Effects of nitric oxide (NO) produced at different hours during imbibition on dormancy break and abscisic acid (ABA) contents of Arabidopsis seeds. (a) Seeds were imbibed with water (CK), sodium nitroprusside (SNP; S) or c-2-phenyl-4,4,5,5-tetramethyl imidazoline-1-oxyl-3-oxide (c-PTIO; P) solutions initially and then transferred from SNP and c-PTIO to water at different times during imbibition. Germination rate was detected after 7d of

imbibition. (b) Seeds were imbibed with water and were scavenged for NO with c-PTIO at each 3h at the first 24h imbibition.

Germination rate was detected after 7d of imbibition. (c) Abscisic acid contents under the different treatments in (b). Values are means with SE (n =4).

Research

1040breaking seed dormancy needs expression of this gene and the action of ABA 8′-hydroxylase, encoded by CYP707A2.

Nitric oxide concentration rapidly increased at the first 3h of imbibition, reached its maximum at c .3h, and then decreased. These results could also be used to explain how scavenging NO at the first stage of imbibition decreased ABA catabolism and after 12h imbibition scavenging NO affected seed dormancy and ABA catabolism slightly (Figs 2, 10). The peak of NO released appeared at the first stage of imbibition,and if the peak was scavenged by c-PTIO, the rapid increase of transcription of CYP707A2 and the 8′-hydroxylase protein encoded by CYP707A2 disappeared (Figs 7, 8). We found that transcription of ABA catabolism genes increased rapidly in the first 6h of imbibition and decreased after 6h, while transcription of biosynthesis genes decreased in the first 6h and increased after 6h (Fig.3). There was no obvious change in ABA concentration after 12h imbibition, although the concentration was still higher in some treatments or mutants (Figs 2, 5). These results showed that ABA catabolism and biosynthesis may have reached a balance after 12h of imbibi-tion. If ABA could not be rapidly decreased at the first stage of imbibition, it would stay at a higher concentration, which would maintain dormancy. Therefore the NO-induced rapid decrease in ABA is required for breaking seed dormancy.It should be noted that although our data for NO treatments suggest that NO is required for the subsequent hormonal regulation and breaking of dormancy, the endogenous NO should be carefully measured in both dormancy and non-dormancy seeds before a convincing relationship between NO production and breaking of dormancy can be established.Since NO scavenger PTIO did not affect the germination of nondormancy seeds but strongly inhibited the germination of dormancy seeds (Fig.1), it is not sure whether NO release and its control mechanism are very different between the dormancy and nondormancy seeds. Further study with accurate NO detection is needed to clarify this.

The site of NO release during imbibition was reported by Sarath et al . (2007) as being largely in the aleurone layer in warm-season C 4 grasses. Our fluorescent images suggested that NO is concentrated in the endosperm layer (or what is some-times referred to as the aleurone layer) that surrounds the embryo and cotyledons (Fig.2). Aleurone layer has been suggested to be the primary determinant of seed dormancy (Bethke et al .,2007). In some dicotyledonous plants it responds to NO, GA and ABA, and is sufficient to control the embryo seed dormancy if the seed coat-controlled dormancy can be considered separately (Bethke et al ., 2007).

In summary, our results demonstrated that CYP707A2 and ABA 8′-hydroxylase encoded by CYP707A2 plays a central role in ABA catabolism during imbibition in Arabidopsis.Nitric oxide acts in regulating the transcription of CYP707A2.Our results also demonstrated that rapidly accumulated NO at the first stage of imbibition is required for rapid ABA catabolism and breaking of seed dormancy. Although we have

demonstrated that NO is involved in seed dormancy and germination control, how NO rapidly accumulates at this stage is still unclear. Further study is required to elucidate this process.

Acknowledgements

This work was supported by Hong Kong Research Grants Council (HKBU262307) and University Grants Committee of Hong Kong (AoE/B-07/99).

References

Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R et al . 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana . Science 301: 653–657.Asami T, Sekimata K, Wang JM, Yoneyama K, Takeuchi Y, Yoshida S. 1999. Preparation of (±)-[1,2-13C 2] abscisic acid for use as a stable and pure internal standard. Journal of Chemical Research. Synopses 11: 658–659.Batak I, Devic M, Giba Z, Grubisic D, Poff KL, Konjevic R. 2002. The effects of potassium nitrate and NO-donors on phytochrome A and phytochrome B-specific induced germination of Arabidopsis thaliana seeds. Seed Science Research 12: 253–259.

Beligni MV, Lamattina L. 2000. Nitric oxide stimulates seed germination and de-etiolation, and inhibits hypocotyls elongation, three light-inducible responses in plants. Planta 210: 215–221.

Beligni MV, Lamattina L. 2001a. Nitric oxide in plants: the history is just beginning. Plant, Cell & Environment 24: 267–278.

Beligni MV, Lamattina L. 2001b. Nitric oxide: a nontraditional regulator of plant growth. Trends in Plant Science 6: 508–509.

Bentsink L, Jowett J, Hanhart CJ, Koornneef M. 2006. Cloning of DOG1, a quantitative trait locus controlling seed dormancy in Arabidopsis. Proceedings of the National Academy of Sciences, USA 103: 17042–17047.Bethke PC, Badger MR, Jones RL. 2004. Apoplastic synthesis of nitric oxide by plant tissues. Plant Cell 16: 332–341.

Bethke PC, Libourei IG, Aoyama N, Chung YY, Still DW, Jones RL. 2007. The Arabidopsis aleurone layer responds to nitric oxide, gibberellin, and abscisic acid and is sufficient and necessary for seed dormancy. Plant Physiology 143: 1173–1188.

Bethke PC, Libourei IG, Jones RL. 2006a. Nitric oxide reduces seed dormancy in Arabidopsis . Journal of Experimental Botany 57: 517–526.Bethke PC, Libourei IG, Jones RL. 2006b. Sodium nitroprusside, cyanide, nitrite, and nitrate break Arabidopsis seeds dormancy in a nitric oxide-dependent manner. Planta 223: 805–812.

Bewley JD. 1997. Seed germination and dormancy. Plant Cell 9: 1055–1066.

Bewley JD, Black M. 1994. Seeds: physiology of development and germination . New York, NY, USA: Plenum Press.

Bright J, Desikan R, Hancock JT, Weir IS, Neill SJ. 2006. ABA induced NO generation and stomatal closure in Arabidopsis are dependent on H 2O 2 synthesis. Plant Journal 45: 113–122.

Carrera E, Holman T, Medhurst A, Dietrich D, Footitt S, Theodoulou FL, Holdsworth MJ. 2008. Seed after-ripening is a discrete developmental pathway associated with specific gene networks in Arabidopsis. Plant Journal 53: 214–224.

Cheng WH, Endo A, Zhou L, Penney J, Chen HC, Arroyo A, Leon P, Nambara E, Asami T, Seo M, Koshiba T, Sheen J. 2002. A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signaling and abscisic acid biosynthesis and functions. Plant Cell 14: 2723–2743.Clough SJ, Bent AF. 1998. Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana . Plant J 16: 735–743.

Research

1041

Corpas FJ, Barroso JB, Carreras A, Quiros M, Leon AM, Romero-Puertas MC, Esteban FJ, Valderrama R, Palma JM, Sandalio LM et al . 2004. Cellular and subcellular localization of endogenous nitric oxide in young and senescent pea plants. Plant Physiology 136: 2722–2733.Creelman RA, Bell E, Mullet JE. 1992. Involvement of a

lipoxygenase-like enzyme in abscisic acid biosynthesis. Plant Physiology 99: 1258–1260.

Culter AJ, Krochko JE. 1999. Formation and breakdown of ABA. Trends Plant Sci 4: 472–478.

Debeaujon I, Koornneef M. 2000. Gibberellin requirement for

Arabidopsis seed germination is determined both by testa characteristics and embryonic abscisic acid. Plant Physiology 122: 415–424.

Delledonne M. 2005. NO news is good news for plants. Current Opinion in Plant Biology 8: 1–7.

Desikan R, Griffiths R, Hancock J, Neill SJ. 2002. A new role for an old enzyme: nitrate reductase-mediated nitric oxide generation is required for abscisic acid-induced stomatal closure in Arabidopsis thaliana . Proceedings of the National Academy of Sciences, USA 99: 16314–16318.

Durner J, Klessig DF. 1999. Nitric oxide as a signal in plants. Current Opinion in Plant Biology 2: 369–374.

Finch-Savage WE, Leubner-Metzger G. 2006. Seed dormancy and the control of germination. New Phytologist 171: 501–523.

Finkelstein RR, Gampala SSL, Rock CD. 2002. Abscisic acid signaling in seeds and seedlings. Plant Cell 14: S15–S45.

Foissner I, Wendehenne D, Langebartels C, Durner J. 2000. In vivo

imaging of an elicitor-induced nitric oxide burst in tobacco. Plant Journal 23: 817–824.

Fujii H, Verslues PE, Zhu JK. 2007. Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis . Plant Cell 19: 485–494.

Garcia-Mata C, Lamattina L. 2001. Nitric oxide induces stomatal closure and enhances the adaptive plant responses against drought stress. Plant Physiology 126: 1196–1204.

Han SY, Kitahata N, Sekimata K, Saito T, Kobayashi M, Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K, Yoshida S, Asami T . 2004. A novel inhibitor of 9-cis -epoxycarotenoid dioxygenase in abscisic acid biosynthesis in higher plants. Plant Physiology 135: 1574–1582.

Himmelbach A, Yang Y, Grill E. 2003. Relay and control of abscisic acid signaling. Current Opinion in Plant Biology 6: 470–479.

Hoffmann-Benning S, Kende H. 1992. On the role of abscisic acid and gibberellin in the regulation of growth in rice. Plant Physiology 99: 1156–1161.

Holdsworth MJ, Bentsink L, Soppe WJJ. 2008. Molecular networks regulating Arabidopsis seed maturation, after-ripening, dormancy and germination. New Phytologist 179: 33–54.

Kitahat N, Saito S, Miyazawa Y, Taishi U, Yukihisa S, Min YK, Mizutani M, Hirai N, Shinozaki K, Yoshida S et al . 2005. Chemical regulation of abscisic acid catabolism in plants by cytochrome P450 inhibitors. Bioorganic & Medicinal Chemistry 13: 4491–4498.

Klepper LA. 1979. Nitric-oxide (NO) and nitrogen-dioxide (NO 2)

emissions from herbicide-treated soybean plants. Atmospheric Environment 13: 537–542.

Kopyra M, Gwó1d 1 EA. 2003. Nitric oxide stimulate seed germination and counteracts the inhibitory effect of heavy metals and salinity on root growth of Lupinus luteus . Plant Physiology and Biochemistry 41: 1011–1017.

Kushiro T, Okamoto M, Nakabayashi K, Yamagishi K, Kitamura S, Asami T, Hirai N, Koshiba T, Kamiya Y, Nambara E. 2004. The Arabidopsis cytochrome P450 CYP707A encodes ABA 8′-hydroxylases: key enzymes in ABA catabolism. EMBO Journal 23: 1647–1656.

Kuwabara A, Ikegami K, Koshiba T, Nagata T . 2003. Effects of ethyleneand abscisic acid upon heterophylly in Ludwigia arcuata (Onagraceae). Planta 217: 880–887.

Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685.

Lamattina L, Garcia-Mata C, Graziano M, Pagnussat G. 2003. Nitric oxide: the versatility of an extensive signal molecule. Annual Review of Plant Biology 54: 109–136.

Lamotte O, Courtois C, Barnavon L, Pugin A, Wendehenne D. 2005. Nitric oxide in plants: the biosynthesis and cell signaling properties of a fascinating molecule. Planta 221: 1–4.

Leshem YY, Wills RBH, Ku VVV. 1998. Evidence for the function of the free radical gas – nitric oxide as an endogenous maturation and senescence regulating factor in higher plants. Plant Physiology and Biochemistry 36: 825–833.

Liu Y, Koornneef M, Soppe WJJ. 2007. The absence of histone H2B monoubiquitination in the Arabidopsis hub1 (rdo4) mutant reveals a role for chromatin remodeling in seed dormancy. Plant Cell 19: 433–444.Luerssen K, Kirik V, Herrmann P, Misera S. 1998. FUSCA3 encodes a protein with a conserved VP1/ABI3-like B3 domain which is of functional importance for the regulation of seed maturation in Arabidopsis thaliana . Plant Journal 15: 755–764.

Millar AA, Jacobsen JV, Ross JJ, Helliwell CA, Poole AT, Scofield G, Reid JB, Gubler F . 2006. Seed dormancy and ABA metabolism in Arabidopsis and barley: the role of ABA 8′-hydroxylase. Plant Journal 45: 942–954.Müller K, Tintelnot S, Leubner-Metzger G. 2006. Endosperm-limited Brassicaceae seed germination: abscisic acid inhibits embryo-induced endosperm weakening of Lepidium sativum (cress) and endosperm rupture of cress and Arabidopsis thaliana . Plant Cell Physiology 47: 864–877.Murgia I, Delledonne M, Soave C. 2002. Nitric oxide mediates iron-induced ferritin accumulation in Arabidopsis . Plant Journal 30: 521–528.Nakajima M, Shimada A, Takashi Y, Kim YC, Park SH, Ueguchi-Tanaka M, Suzuki H, Katoh E, Iuchi S, Kobayashi M et al . 2006. Identification and characterization of Arabidopsis gibberellin receptors. Plant Journal 46: 880–889.

Nambara E, Marion-Poll A. 2005. Abscisic acid biosynthesis and catabolism. Annual Review of Plant Biology 56: 165–185.

Neill SJ, Barros R, Bright J, Desikan R, Hancock J, Harrison J, Morris P, Ribeiro D, Wilson I. 2008. Nitric oxide, stomatal closure, and abiotic stress. Journal of Experimental Botany 59: 165–176.

Neill SJ, Desikan D, Clarke A, Hancock JT. 2002. Nitric oxide is a novel component of abscisic acid signaling in stomatal guard cells. Plant Physiology 128: 13–16.

Neill SJ, Desikan R, Hancock JT. 2003. Nitric oxide signaling in plants. New Phytologist 159: 11–35.

Ogawa M, Hanada A, Yamauchi Y, Kuwalhara A, Kamiya Y, Yamaguchi S. 2003. Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell 15: 1591–1604.

Okamoto M, Kuwahara A, Seo M, Kushiro T, Asami T, Hirai N, Kamiya Y, Koshiba T, Nambara E. 2006. CYP707A1 and CYP707A2, which encode abscisic acid 8′-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis. Plant Physiology 141: 97–107.

Raz V, Bergervoet JHW, Koornneef M. 2001. Sequential steps for

developmental arrest in Arabidopsis seeds. Development 128: 243–252.del Rio LA, Corpas FJ, Barroso JB. 2004. Nitric oxide and nitric oxide synthase activity in plants. Phytochemistry 65: 783–792.

Rockel P, Strube F, Rockel A, Wildt J, Kaiser WM. 2002. Regulation of nitric oxide (NO) production by plant nitrate reductase in vivo and in vitro . Journal of Experimental Botany 53: 103–110.

Romero-Puertas MC, Perazzolli M, Zago ED, Delledonne M. 2004. Nitric oxide signalling functions in plant–pathogen interactions. Cellular Microbiology 6: 795–803.

Saito S, Hirai N, Matsumoto C, Ohigashi H, Ohta D, Sakata K, Mizutani M. 2004. Arabidopsis CYP707As encode (+)-abscisic acid 8′-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid. Plant Physiology 134: 1439–1449.

Sarath G, Hou G, Baird LM, Mitchell RB. 2007. Reactive oxygen species, ABA and nitric oxide interactions on the germination of warm-season C4-grasses. Planta 226: 697–708.

Research

1042Seo M, Aoki H, Koiwai H, Kamiya Y, Nambara E, Koshiba T . 2004. Comparative studies on the Arabidopsis aldehyde oxidase (AAO) gene family revealed a major role of AAO3 in ABA biosynthesis in seeds. Plant & Cell Physiology 45: 1694–1703.

Seo M, Koiwai H, Akaba S, Komano T, Oritani T, Kamiya Y, Koshiba T. 2000. Abscisic aldehyde oxidase in leaves of Arabidopsis thaliana . Plant Journal 23: 481–488.

Steber CM, McCourt P . 2001. A role for brassinosteroids in germination in Arabidopsis. Plant Physiology 125: 763–769.

Wendehenne D, Pugin A, Klessig DF, Durner J. 2001. Nitric oxide:

comparative synthesis and signaling in animal and plant cells. Trends Plant Sci 6: 177–183.

Wendehenne D, Durner J, Klessig DF. 2004. Nitric oxide: a new player in plant signaling and defense responses. Current Opinion in Plant Biology 7: 449–455.

Zeevaart JAD, Creelman RA. 1988. Metabolism and physiology of abscisic acid. Annual Review of Plant Physiology and Plant Molecular Biology 39: 439–473.

Zhang AY, Jiang MY, Zhang JH, Tan MP, Hu XL. 2007. Nitric oxide induced by hydrogen peroxide mediates abscisic acid-induced activation of the mitogen-activated protein kinase cascade involved in antioxidant defense in maize leaves. New Phytologist 175: 35–60.

About

New Phytologist

?New Phytologist is owned by a non-profit-making charitable trust dedicated to the promotion of plant science, facilitating projects from symposia to open access for our Tansley reviews. Complete information is available at https://www.360docs.net/doc/e313039073.html, .

?Regular papers, Letters, Research reviews, Rapid reports and both Modelling/Theory and Methods papers are encouraged.We are committed to rapid processing, from online submission through to publication ‘as-ready’ via Early View – our average submission to decision time is just 29 days. Online-only colour is free , and essential print colour costs will be met if necessary.We also provide 25 offprints as well as a PDF for each article.?For online summaries and ToC alerts, go to the website and click on ‘Journal online’. You can take out a personal subscription to the journal for a fraction of the institutional price. Rates start at ￡139 in Europe/$259 in the USA & Canada for the online edition (click on ‘Subscribe’ at the website).

?If you have any questions, do get in touch with Central Office (newphytol@https://www.360docs.net/doc/e313039073.html, ; tel +44 1524 594691) or, for a local contact in North America, the US Office (newphytol@https://www.360docs.net/doc/e313039073.html, ; tel +1 865 576 5261).