Effects of vitamin D on the growth of normal and malignant B-cell progenitors

Clin Exp Immunol 2001;126:214±219

Effects of vitamin D on the growth of normal and malignant B-cell progenitors

R.CONSOLINI*,S.PALA*,A.LEGITIMO*,G.CRIMALDI*,S.FERRARI2&S.FERRARI2*Dipartimento di

Medicina della Procreazione e dell'Eta

áEvolutiva,Istituto di Clinica Paediatrica,Universita ádi Pisa,Italy,and 2Dipartimento di Scienze Biomediche,Sezione di Chimica Biologica,Universita

ádi Modena e di Reggio Emilia,Italy (Accepted for publication 16July 2001)

SUMMARY

As the effects of vitamin D 3,1,25-dihydroxyvitamin D 3(1,25-(OH)2-D 3)(VD,calcitriol)on the

proliferation and differentiation potential of normal and leukaemic cells in vitro of myeloid lineage are known,we investigated the response to VD on the growth of both normal and malignant lymphoid progenitors.Effects of vitamin D on normal human lymphoid progenitors and B lineage acute lymphoblastic leukaemia (ALL)progenitors were assessed by using an in vitro cell colony assay specific for either B or T cell lineages.The expression of VDR on B untreated malignant progenitors at diagnosis was investigated by RT-PCR analysis.VD induced a significant inhibition of normal lymphoid cell progenitors growth of both T and B lineage.VD inhibited significantly also the growth of malignant B cell lineage lymphoid progenitors,without inducing cytotoxic effect.As it has been reported that VD effects on activated lymphocytes are mediated by 1,25-(OH)2-D 3nuclear receptor (VDR),we investigated VDR expression on malignant B cell progenitors.We did not detect VDR expression on these cells examined at diagnosis.We demonstrated that VD inhibited in vitro the clonogenic growth of both normal and malignant lymphoid B cell progenitors and that this inhibitory effect on malignant B cell progenitors was not related to VDR.Our work contributes to understanding of the mechanism of action of this hormone in promoting cellular inhibition of clonal growth of malignant lymphoid B cell progenitors,suggesting that the regulation of some critical growth and differentiation factor receptors could be a key physiological role of this hormone.Keywords

1,25-(OH)2-D 3

colony assay

lymphoid progenitors

vitamin D receptor

INTRODUCTION

The dihydroxylated form of vitamin D 3(1,25-(OH)2-D 3),as an immunohaematopoietic regulatory hormone,has been investi-gated extensively in the past few years.Most of the biological actions of VD are now thought to be exerted through the nuclear VD receptor (VDR)-mediated control of target genes.VDR belongs to the nuclear hormone receptor superfamily and acts as a ligand-inducible transcription factor [1].

VD is able to induce differentiation in several haematological cells and may play an immunomodulating role in cellular proliferation for a number of malignant cell types [2].In particular,previous studies suggested that myeloid precursors at all stages of differentiation are equipped with the machinery required to trigger a VD-dependent genetic programme,leading eventually to terminal differentiation [3].In other words,they contain VDR protein that is fully active in binding their DNA sites and in promoting transcription [3].

To gain some insight into the VD activity on lymphoid lineage,we studied the effect of this hormone on the growth of normal and malignant lymphoid progenitors,by using an in vitro cell colony assay specific for either B or T cell lineages and investigated the expression of VDR on B untreated malignant progenitors.

Our work showed that VD significantly inhibited the growth of normal and malignant lymphoid progenitors without inducing a cytotoxic effect.As we did not detect VDR expression on leukaemic blast cells examined at diagnosis,our data indicate that VD inhibitory effect on these cells is not related to VDR.

MATERIALS AND METHODS

Normal and patient samples

Ten normal subjects and 10B lineage acute lymphoblastic leukaemia (ALL)patients,age ranging from 2to 10years,were included in the study.Diagnosis of B lineage ALL was performed on the basis of morphological,cytochemical and immunological surface marker profiles of marrow blasts,according to the French±American±British (FAB)criteria [4]and Italian±Ber-lin±Frankfurt±Muenster Study Group (I-BFM-SG)[5].All cases

214

q 2001Blackwell Science

Correspondence:Rita Consolini MD,Dipartimento di Medicina della

Procreazione e dell'Eta

áEvolutiva,Istituto di Clinica Paediatrica,Universita

ádi Pisa,Via Roma,67,56100Pisa,Italy E-mail:rita.consolini@dp.med.unipi.it

were classified as B cell precursor ALL(BCP-ALL),either common ALL(CD191,HLA-DR1,CD101,CyIgM-,six cases)or pre-B ALL(CD191,HLA-DR1,CD101,CyIgM1,four cases). Two B lineage leukaemic cell lines,Nalm6and REH,were available from the German Collection of Microorganisms and Cell Cultures Department of Human and Animal Cell Cultures, Mascheroder Weeg1b,Germany)and were maintained in RPMI-1640tissue culture medium(G ibco,Milano,Italy)with 10%fetal calf serum(FCS,G ibco)

Cell separation

Mononuclear cells(MNC)were isolated by Ficoll-Hypaque density centrifugation(Pharmacia Fine Chemicals,Uppsala, Sweden).Subsequently,MNC were depleted of adherent cells by2h incubation in a-MEM(G ibco)with20%of FCS(G ibco) at378C,followed by collection of non-adherent cells by gentle pipetting.To isolate T and B cells,E rosette-forming T lymphocytes were removed by rosetting MNC with2-aminoethy-lisothio uronium bromide(AET)(Sigma Chemical Co.,St Louis, USA)-treated sheep red blood cells(SRBC)and successive Ficoll separation[6].The B cell-enriched population contained,0′5% E rosette-forming T cells.E rosette-enriched cells were collected from the pellet after hypotonic lysis of the SRBC.The purity of both populations was evaluated by flow cytometry(FACScan instrument and Cell Quest software:Becton Dickinson).The technique of lymphocyte gating was performed by combining the light-scattering gate and the expression of human leucocyte antigen CD45conjugated to phycoerythrin(PE;Caltag Labora-tories;Burlingame,CA,USA)to differentiate lymphocytes.The B cell-enriched population was incubated with Leu-12(anti-CD19) monoclonal antibody(MoAb)conjugated to fluorescein isothio-cyanate(FITC;Caltag Laboratories)and CD45.The T cell population was incubated with anti-CD3-FITC(Leu4,Becton Dickinson)and CD45-PE.They contained91%of CD45/CD191 cells and more than92%of CD45/CD31cells,respectively.

Colony assay

We have reported previously the different biological properties of normal B and T cell precursors[7].The method of Izaguirre et al.

[8]was used for B cell colony assay,as described previously[7,9±11].In brief,2?105cells from the E2cell fraction were seeded in0′8%methylcellulose in minimal essential medium(MEM), supplemented with10%FCS,20%of a T conditioned medium (PHA-TCM)and3?105irradiated T lymphocytes,obtained from two normal donors.Conditioned medium by PHA-stimulated purified T lymphocytes was obtained by incubating purified T lymphocytes at a concentration of106/ml for3days.The plates were incubated at378C for5days in a moist atmosphere under hypoxaemic conditions(7%O2in air).For T colony assay, medium conditioned by PHA-stimulated peripheral blood lym-phocytes(PBL)(PHA-LCM)was prepared by incubating106/ml PBL and used as source of growth factors.Cells(2?105) obtained from the E1cell fraction were seeded in0′8% methylcellulose in MEM,supplemented with10%FCS and 20%of PHA-LCM.Cultures were incubated for5days at378C in a humidified atmosphere of5%CO2in air.The same T lymphocyte donors and PHA-CM batch were used throughout this study.

Treatment of cells with1,25-(OH)2-D3

VD was dissolved in absolute ethanol at1023mol/l in order to create a stock solution that was then protected from light and stored at2208C.Further dilutions of the stock solution were made in MEM without FCS.A dose±response curve was performed by testing different VD concentrations(from10211 to1026)on the population of enriched B and T cell precursors. We added VD alone or in association with the conditioned medium to the test wells at final concentration of1026m.In control wells,absolute ethanol was added at a concentration equivalent to that present in the highest concentration of VD (0′01%).

Characterization of colony forming cells

Aggregates containing.20and.50cells,respectively,were counted as B and T colonies under an inverted microscope. Colonies were drawn up with a fine capillary pipette containing cold phosphate-buffered saline(PBS),pooled and washed for further morphological and immunological characterization,as described previously[7,9±11].In colony-forming units(CFU)-B lineage the colony-forming cells(CFC)were phenotyped for the presence of CD10(J5,Instrumentation Laboratories,Coulter, Milan,Italy),HLA-DR(OKDR,Ortho Diagnostic Systems, Milan,Italy)and sIg(antihuman Ig F(antibody),Behring, L'Aquila,Italy)expression.In CFU-T lineage colonies the CFC were phenotyped for CD7(Leu9,Becton Dickinson,Milan,Italy), CD3(Leu4,Becton Dickinson)and CD38(OKT10,Ortho Diagnostic Systems)expression.Isotypic controls were always added.Non-specific binding was prevented by incubation with AB serum.

Assesment of cytotoxicity and apoptosis

Cytotoxicity and apoptosis were evaluated by flow cytometry in two B lineage cell lines(Nalm-6and REH)and two B cell precursor ALL,as described previously[12,13].Cell lines and leukaemic samples were incubated for48and72h,respectively, with VD from1026m to1028m.

At the beginning of the cultures,we set`gates'around the area of the light-scatter dot plot that included virtually all blast cells. We used these gates to count cells with the predetermined light-scatter properties that were present after culture with and without VD.The formula(number of cells recovered with VD/number of cells recovered in parallel culture without VD)?100was used to calculate relative cell recovery after VD treatment.All results are reported as the mean of triplicate experiments.To detect the occurrence of apoptosis,we also measured cell labelling with FITC-conjugated Annexin-V(Bender MedSystems;MedSystems Diagnostics GmbH,A-1030Vienna,Austria),which binds to phosphatidylserine exposed on the surface of apoptotic cells.To detect cell membrane permeabilization,cells were labelled with propidium iodide(5mg/ml;Bender MedSystems)for15min at 208C.

RNA analysis

Total cellular RNA was extracted using a modification of the guanidium±caesium chloride centrifugation technique[14]and digested with RQ1-DNase(Promega,Madison,WT,USA)to avoid DNA contamination,as described previously[15].Reverse transcription polymerase chain reaction(RT-PCR)was carried out using a modification of a previously described technique[15].RT-PCR analysis was performed using an oligodeoxynucleotide primers specific for VDR[16,17]and b2microglobulin(b2m) [18].The oligonucleotides used as DPs or RPs were as follows:(a)

VD effects on lymphoid progenitors215 q2001Blackwell Science Ltd,Clinical and Experimental Immunology,126:214±219

VDR-DP (5-GGAGACTTTGACCGGAACGTG-3)and VDR-RP (5GAACTGGCAGAAGTCGGAGTA-3);(b)VDR primary transcript-DP (5±CAGTGACGTGACCAAAGGTATGCC TAG -3)and VDR primary transcript-RP (5-GGGAGAC GATGCAGATGGCCATGAGCA-3);and (c)b 2m-DP (5±CTCGCGCTACTCTCTCTTTCT-3)and b 2m-RP (5±TCCATTCTTCAGTAAGTCAACT-3).

RESULTS

Clonogenic responses of normal peripheral haematopoietic lymphoid precursors to VD

Ethanol,the vehicle for VD,had no effect on cell viability.The maximal inhibitory responsiveness to VD was observed at 1026m for both cell lymphoid populations,suggesting that,at this VD concentration,target cells presented the highest avidity to VDR.B and T cell progenitors from normal controls generated 54^15′87and 64′6^30′9colonies/105cells,respectively,when PHA-TCM and PHA-LCM were used as the source of stimulation.The addition of calcitriol to the positive control showed a significant inhibition (P ,0′05)in both B and T lineage colonies (Table 1).PHA alone induced clusters that were not reduced significantly by the addition of calcitriol in both T and B lineage colonies.Effect of VD on cell viability

To determine whether VD was cytotoxic against leukaemic cells

we assessed light-scatter variations of pre-and post-VD-treated cell samples.Nalm 6and REH cell lines showed 96′6^1′2and 68′5^1′9%of viable cells,respectively,in the control versus

00

50

100Side scatter

150200250

50100F S C -h e i g h t

150200250

(a)R3

00

101102103

104

Annexin-V FITC

3060C o u n t s

C o n t r o l 90120

150(b)28·9%

M1

00

50

100Side scatter

150200250

50100F S C -h e i g h t

150200250

(c)R3

101

102103104

Annexin-V FITC

3060C o u n t s

V D

90120150(d)

33·3%

M1

Fig.1.VD cytotoxicity in one case of ALL as measured by flow cytometry.Panels (a)and (c)show side-scatter (SSC)versus forward-scatter (FSC)of leukaemic lymphoblasts after 48h of culture without and with VD (10-7m ),respectively.(b)and (d)Binding of fluorescein-Annexin-V after 48h of culture without and with VD,respectively.

Table 1.Effect of 1,25(OH)2D 3on the growth of normal and malignant

lymphoid progenitors

Progenitor cells Sample Source of stimulation

Colonies/105cells

Mean (s.d.)

B-lineage

PB None

0(0)PHA-TCM 54(15.8)1,25(OH)2D 3

0(0)1,25(OH)2D 31PHA-TCM

12.7(6.97)T-lineage

PB None

0(0)PHA-LCM 64.6(30.1)1,25(OH)2D 3

0(0)1,25(OH)2D 31PHA-TCM

23.2(7.89)

B-lineage ALL

BM

None

2.1(1)PHA-TCM 50(8.5)1,25(OH)2D 3

8.3(3.5)1,25(OH)2D 31PHA-TCM

11.7(3.1)

PB:peripheral blood;BM:bone marrow;PHA-LCM:PHA-leucocyte conditioned medium;PHA-TCM:PHA-T lymphocytes conditioned medium.

216

R.Consolini et al.

q 2001Blackwell Science Ltd,Clinical and Experimental Immunology ,126:214±219

93′6^0′8and 68′1^2′6%in the culture treated with VD at a concentration of 1026m .Overlapping results were observed at the other tested concentrations (1027m ,1028m )and similarly in two B lineage ALL (Fig.1).The investigation of apoptosis by labelled Annexin-V did not show any difference between control and following VD treatment in the two B lineage ALL samples,confirming the above results (Fig.1).

Clonogenic response of malignant B cell progenitors

Malignant B cell progenitors from ALL were cultivated in a semisolid assay at an optimal concentration of 2?105cells/ml.The addition of VD to the positive control showed a significant inhibition of the growth in B colony assays (mean:50^8′5versus 11′7^3′1;P ,0′05)(Table 1).Similar to that observed in normal B progenitors,the addition of calcitriol to PHA in the colony assay did not significantly reduced the clusters'number.Characterization of colony-forming cells

Morphological examination of CFU from normal and neoplastic progenitors did not present any difference between control and VD-inhibited colonies,showing lymphoblastoid appearance in both cases.Immunophenotypic analysis of pooled colony-forming cells (CFC)from normal T and B cell progenitors indicated the presence of mature markers of B and T cell lineage both in PHA-CM-induced colonies (positive control)and in calcitriol-inhibited assays.Immunophenotypic analysis of pooled CFC from two B lineage ALL patients did not show any differentiation effect by confirming the immunological characterization observed on fresh blast cells.

VDR expression on ALL blast cells

To clarify whether the VD effect on malignant lymphoid progenitors could be related to the expression of VDR,we performed RT-PCR analysis in four ALL patients by examining their frozen blast cells at diagnosis.RT-PC products and b 2m mRNA were used to monitor the presence of the RNA in each sample and reported in Fig.2,lanes 5±8.

Figure 2shows that VDR mRNA are not detectable in all samples examined (four of four patients,lanes 1±4).One of the

four patients,lane 5,was not available for the contemporary absence of both VDR and b 2m (RNA).

DISCUSSION

VD is not only the positive regulator of the calcium homeostasis,but also an immunomodulator.It has been reported that it inhibits T lymphocyte proliferation [19],as well as B cell differentiation and the antibody response [20].The physiological role of VD on normal haematopoiesis is,however,not fully elucidated.These biological activities on the immune system are mediated by binding to nuclear receptor for 1,25-(OH)2-D 3[21],which belongs to the steroid receptor superfamily,and acts as a ligand-inducible transcription factor [22].Its appearance on lymphocytes coincides with cell entry into G1phase of the cell cycle,and the concentration of the receptor protein reaches a peak at G1beta and declines during the S phase [19].In our work,we show that VD inhibits clonogenic growth of in vitro normal activated lymphoid B and T cell progenitors.

VD is also a differentiation-inducing agent and an important modulator of cellular proliferation for a number of malignant cell types.The presence of its receptor has been shown in breast cancer [23],in human melanoma [24],neuroblastoma [25],prostate cancer [26]and myeloid leukaemia cells [27].Concerning myeloid lineage,it has been reported previously that myeloid precursors at all stages of differentiation are equipped with the machinery required to trigger the VD-dependent genetic pro-gramme,leading eventually to terminal differentiation.In other words,they contain VDR protein that is fully active in binding their sites and in promoting transcription [13].Recently it has been shown that VD induces differentiation of a retinoid acid-resistant acute promyelocytic leukaemia cell line (UF-1)[28]and that VD-responsive genes are induced by all-trans-retinoic acid treatment of M2-type leukaemic blast cells [27].

Conversely,the activity of VD on the growth and differentia-tion of acute lymphoid leukaemia cells have scarcely been investigated.Therefore,we turned our attention to the effects of this hormone on B lineage malignant progenitor cells.We have demonstrated that VD inhibited in vitro the growth of B lineage leukaemic cells without inducing a cytotoxic effect.Additionally,in preliminary experiments we observed that VD did not induce differentiation either in semisolid or liquid culture (two B lineage ALL tested;data not shown).VDR expression investigated in frozen B lineage blast cells at diagnosis and before treatment was not detected in all samples tested.As its expression in distinct leukaemic cell lines is regulated differentially upon the effect of proliferation or differentiation inducers [29,30],further investiga-tion should be performed after the beginning of the culture.In addition,as in most antigen expression,the VD receptor is influenced by the cells'relationship with the bone marrow microenvironment [31],and its expression in malignant cryopre-served lymphoblastic cells may not become evident before a brief period of culture.

Furthermore,our results suggest that distinct factors may regulate such an interplay (e.g.VD binding proteins,alterations of cellular oncogenes regulating cellular proliferation and differ-entiation,effect of VD on growth factors modulating haemopoie-tic precursors).In particular,these interactions between VD and growth factors have been demonstrated previously in other cell systems.The capacity of the hormone to modulate the expression of a macrophage-derived cytokine

(granlulocyte-macrophage

Fig.2.Detection by RT-PCR of VDR in four cases of B cell precursors ALL:lanes 1±4.Blast cells were tested at diagnosis.RT-PCR products of b 2mRNA are shown in lanes 5±https://www.360docs.net/doc/9f4573682.html,ne 9shows molecular weight f X174/HAE III marker.The different genes studied and the size of the amplified fragments are labelled on the left and right sides of the panel,respectively.

VD effects on lymphoid progenitors 217

q 2001Blackwell Science Ltd,Clinical and Experimental Immunology ,126:214±219

colony-stimulating factor)[32]and to inhibit IL12production by activated macrophages and dendritic cells by acting at the transcriptional level has been reported[33].The involvement of TGF-beta1in the mechanism of action of VD on some leukaemic cell lines has been demonstrated recently:it is an autocrine mediator of human myelomonocytic U937leukaemia cell growth arrest and differentiation induced by VD and retinoids[34],and is involved in the antiproliferative effect of a VD analogue,EB1089, on HL60cells[35].In human prostate cancer cell lines the VDR content and transcriptional activity do not fully predict anti-proliferative effects of VD,suggesting that growth inhibition by VD requires VDR,but is modulated by non-receptor factors that are cell-line-specific[26].

Our work,together with the above observations,leads us to suggest that the regulation of some critical growth and differentiation factor receptors could play a key physiological role of this hormone.

The possibility of enhancing the effects of VD in vitro by combining the hormone with other molecules such as growth factors or other chemotherapic agents has been explored. Recently the synergistic effect of VD with granulocyte-macro-phage colony-stimulating factor on the differentiation of the human monocytic cell line U937has been demonstrated[36] with interferon-gamma and tumour necrosis factor in inducing the monocytoid differentiation of human promyelocytic cells [37],and with IL4in enhancing its antiproliferative effect on mouse monocytic leukaemia cells[38].Another approach is to combine VD with other inducers of differentiation presenting a synergistic effect[39].The interaction of VD with5-Aza-2H deoxycytidine was shown to be synergistic with respect to the loss of clonogenicity of the HL-60leukaemic cells[40].The combined treatment of VD or its analogue novel20-epi VD and 9-cis retinoic acid has been shown recently to produce a synergistic decrease of clonal proliferation,induction of differentiation and apoptosis of acute promyelocytic leukaemia cells[41].

The clinical use of1,25-(OH)2-D3for leukaemia is limited, due not only to its calcaemic side-effects but also because1,25-(OH)2-D3alone fails to eliminate the leukaemic clone[41].More recently,new vitamin D derivatives have been generated with extraordinarily potent inhibitory effects on leukaemic cell growth in vitro[42],without producing hypercalcaemia[43]and inhibition of normal myeloid clonal proliferation[44].Therefore the synergistic effect of the hormone and its analogues with either chemotherapeutic agents or growth factors must be explored further.

The possibility of using growth inhibitors or inducers of differentiation for the therapy of leukaemias or other tumours has recently received considerable interest.Concerning acute lym-phoblastic leukaemia(ALL),therapy fails in approximately one-third of children and two-thirds of adult patients[45,46].In childhood ALL,particularly,the immediate challenge is to develop new approaches for cases that have relapsed after intensive multi-agent chemotherapy[45].

In conclusion,our work suggests that the in vitro study of VD and its analogues in combination with other drugs or growth factors in acute leukaemias deserves further investiga-tion.Furthermore,it contributes to understanding of the mechanism of action of this hormone in promoting cellular inhibition of clonal growth of malignant lymphoid B cell progenitors.

REFERENCES

1Mangelsdorf DJ,Thummel C,Beato M et al.The nuclear receptor superfamily:the second decade.Cell1995;83:835±9.

2Eisman JA.1,25-dihydroxyvitamin D3receptor and role of1,25-(OH)2D3in human cancer cells.In:Kumar R.ed.Vitamin D.Boston: Martinus-Nijhoff Publishing,1984:365±82.

3Grande A,Manfredini R,Pizzanelli M et al.Presence of a functional vitamin D receptor does not correlate with vitamin D3phenotypic effects in myeloid differentiation.Cell Death Differ1997;4:497±505. 4Bennett JM,Catovsky D,Daniel MT et al.The morfological classification of acute lymphoblastic leukemia:concordance among observers and clinical correlation.Br J Haematol1981;47:553±61. 5Van der Does-Van der Berg A,Bartram C,Basso G et al.Minimal requirements for diagnosis,classification and evaluation of he treatment of childood acute lymphoblastic leukemia(ALL)in the `BFM'Family Cooperative Group.Med Pediatr Oncol1992;20:497±505.

6Madsen M,Johnsen HE,Hansen PW,Christiansen SE.Isolation of human T and B lymphocytes by E rosette gradient centrifugation.

Characterization of the isolated populations.J Immunol Meth1980;

33:323±7.

7Georgoulias V,Marion S,Consolini R,Jasmin C.Characterization of normal peripheral blood T and B cells colony forming cells:growth factors(s)and accessory cell requirements for their in vitro prolifera-tion.Cell Immunol1985;90:1±13.

8Izaguirre CA,Curis J,Messner H,McCulloch EA.A colony assay for blast cell progenitors in non T non B(common)acute lymphoblastic leukemia.Blood1981;7:823±7.

9Consolini R,Bre?ard J,Bourinbaiar S et al.Abnormal in vitro differentiation of peripheral blood clonogenic B cells in common acute lymphoblastic leukemia.Blood1986;67:796±801.

10Consolini R,Legitimo A,Cattani M et al.The effect of cytokines, including IL-4,IL-7,stem cell factor,insulin-like growth factor on childood acute lymphoblastic leukemia.Leuk Res1997;21:753±61. 11Consolini R,Scamardella F,Legitimo A et al.Evaluation of minimal residual disease in high risk childood acute lymphoblastic leukemia using an immunological approach during complete remission.

Haematologica1993;78:297±305.

12Consolini R,Pui C-H,Behm FG,Raimondi S,Campana D.In vitro cytotoxicity of docetaxel in childhood acute leukemias.J Clin Oncol 1998;16:907±13.

13Legitimo A,Consolini R,Di Stefano R,Bencivelli W,Calleri A, Mosca F.Evaluation of the immunomodulatory mechanisms of photochemotherapy in transplantation.Transplant Proc2001;33:1±3. 14MacDonald RJ,Swift GH,Przybyla AE,Chirgwin JM.Isolation of RNA using guanidinium salts.Meth Enzymol1987;152:219±27. 15Grande A,Manfredini R,Tagliafico E et al.All-trans retinoic acid induces simultaneously granulocytic differentiation and expression of inflammatory cytokines in HL60cells.Exp Hematol1995;23:117±25. 16Baker AR,McDonnel DP,Hughes M et al.Cloning and expression of full-length cDNA encoding human vitamin D receptor.Proc Natl Acad Sci USA1988;85:3294±8.

17Miiyamoto K,Kesterson RA,Yamamoto H et al.Structural organization of the human vitamin D receptor chromosal gene and its promoter.Mol Endocrinol1997;11:1165±79.

18Suggs SV,Wallace RB,Hirose T,Kawzshima EH,Itakura https://www.360docs.net/doc/9f4573682.html,e of synthetic oliginucleotides as hybridization probes:isolation of cloned cDNA sequences for human B2-microglobulin.Biotechnology1992;

24:140±4.

19Rigby WF,Noelle RJ,Krause K,Fanger MW.The effects of1,25-dihydroxyvitamin D3on human T lymphocyte activation and proliferation:a cell cycle analysis.J Immunol1985;135:2279±86. 20Chen WC,Vayuvegula B,Gupta S.1,25-dihydroxyvitamin D3-mediated inhibition of human B cell differentiation.Clin Exp Immunol 1987;69:639±46.

21Veldman CM,De Cantorna MT,Luca HF.Expression of1,25-

218R.Consolini et al.

q2001Blackwell Science Ltd,Clinical and Experimental Immunology,126:214±219

dihydroxyvitamin D receptor in the immune system.Arch Biochem Biophys2000;374:334±8.

22Kato S.The function of vitamin D receptor in vitamin D action.J Biochem2000;27:717±22.

23Eisman JA,Martin TJ,MacIntyre I,Moseley JM.1,25-dihydroxyvi-tamin D receptor in breast cancer https://www.360docs.net/doc/9f4573682.html,ncet1979;2:1335±6.

24Evans SR,Houghton AM,Schumaker L et al.Vitamin D receptor and growth inhibition by1,25-dihydroxyvitamin D in human malignant melanoma cell lines.J Surg Res1996;1:127±33.

25Celli A,Treves C,Stio M.Vitamin D receptor in SH±SY5Y human neuroblastoma cells and effect of1,25-dihydroxyvitamin D3on cellular proliferation.Neurochem Int1999;34:117±24.

26Zhuang SH,Schwartz GG,Cameron D,Burnstein KL.Vitamin D receptor content and trascriptional activity do not fully predict antiproliferative effects of vitamin D in human prostate cancer cell lines.Mol Cell Endocrinol1997;126:83±90.

27Manfredini R,Trevisan F,Grande A et al.Induction of a functional vitamin D receptor in all-trans-retinoic acid-induced monocytic differentiation of M2-type leukemic blast cells.Cancer Res1999;

59:3803±11.

28Muto A,Kizaki M,Yamato K et al.1,25-Dihydroxyvitamin D induces differentiation of a retinoid acid-resistant acute promyelocytic leukemia cell line(UF-1)associated with expression of p21(WAF1/ CIP1)p27(KIP1).Blood1999;93:2225±33.

29Folgueira MA,Federico MH,Katayama ML,Silva MR,Brentani MM.

Expression of vitamin D receptor(VDR)in HL-60is differentially regulated during the process of differentiation induced by phorbol ester,retinoic acid or interferon-gamma.J Steroid Biochem Mol Biol 1998;664:193±201.

30Folgueira MA,Federico MH,Roela RA,Maistro S,Katayama ML, Brentani MM.Differential regulation of vitamin D receptor expression in distinct leukemic cell lines upon phorbol ester-induced growth arrest.Braz J Med Biol Res2000;33:559±68.

31Saito M,Kumagai M,Okazaki T et al.Stromal cell-mediated transcriptional regulation of the CD13/aminopeptidase N gene in leukemic cells.Leukemia1995;9:659±67.

32Tobler A,Miller C,Norman AW,Koeffler HP.1,25-dihydroxyvitamin D3modulates the expression of a lymphokine(granulocyte-macro-phage colony-stimulating factor)posttrascriptionally.J Clin Invest 1988;81:1819±23.

33D'Ambrosio D,Cippitelli M,Cocciolo MG et al.Panina±Bordignon P inhibition of IL-12production by1,25-dihydroxyvitamin D.Involv-ment of NF-kappaB downregulation in transcriptional repression of p40gene.J Clin Invest1998;101:252±62.

34Defacque H,Piquemal D,Basset A,Marti J,Commes T.Tranforming growth factor-beta1is an autocrine mediator of U937cell growth arrest

and differentiation induced by vitamin D and retinoids.J Cell Physiol 1999;178:109±19.

35Jung CW,Kim ES,Scol JG et al.Antiproliferative effect of a vitamin

D analog,EB1089,on HL-60cells by the induction of TGF-beta

receptor.Leuk Res1999;23:1105±12.

36Zuckerman SH,Suprenant YM,Tang J.Sinergistic effectof granulo-cyte-macrophage colony-stiulating factor and1,25-dihydroxyvitamin

D on the differentiation of the human monocytic cell line U937.Blood

1988;71:619±24.

37Weinberg JB,Larrik JW.Receptor-mediated monocytoid differentia-tion of human promyelocytic cells by tumor necrosis factor:synergistic actions with interferon-g and1,25-dihydroxyvitamin D3.Blood1987;

70:994±1002.

38Kasukabe T,Okabe-Kado J,Honma Y,Hozumi M.Interleukin-4 inhibits the differentiation of mouse myeloid leukemia M1cells induced by dexamethasone,d-factor/leukemia inhibitory factor and interleukin-6,but not by1,25-dihydroxyvitamin D3.FEBS Lett1991;

291:181±4.

39James SY,Williams MA,Newland AC,Colston K.Leukemia cell differentiation:cellular and molecular interactions of retinoid and vitamin D.Gene Pharmacol1999;2:143±54.

40Momparler RL,DoreáBT,LabiberteáJ,Momparler LF.Interaction of5-Aza-2H-deoxycytidine with amsacrine or1,25-dihydroxyvitamin D3,on HL-60myeloid leukemic cells and inhibitors of cytidine deaminase.

Leukemia1992;7:17±20.

41Elstner E,Linker-Israeli M,Le J et al.Synergistic decrease of clonal proliferation,induction of differentiation,and apoptosis of acute promyelocytic leukemia cells after combined treatment with novel20-epi vitamin D3analogs and9-cis retinoic acid.J Clin Invest1997;

99:349±60.

42Pakkala S,Devos S,Elstner B et al.Vitamin D3analogs:effects on leukemic clonal growth differentiation and on serum calcium levels.

Leuk Res1995;19:65±70.

43Zhou J-Y,Norman AW,Akashi M et al.Development of a novel 1,25(OH)2-vitamin D3analog with potent ability to induce HL-60cell differentiation without modulating calcium metabolism.Blood1991;

78:75±82.

44Asou H,Koike M,Elstner E et al.19-nor vitamin D analogs:a new class of potent inhibitors of proliferation and inducers of differentiation of human myeloid leukemia cell lines.Blood1998;92:2441±9.

45Rivera GK,Raimondi SC,Hancock ML et al.Improved outcome in childood acute lymphoblastic leukemia with reiforced early treatment and rotational combination https://www.360docs.net/doc/9f4573682.html,ncet1991;337:61±6. 46Hoelzer D.High-dose chemotherapy in adult acute lymphoblastic leukemia.Semin Hematol1991;28:84±9.

VD effects on lymphoid progenitors219 q2001Blackwell Science Ltd,Clinical and Experimental Immunology,126:214±219