sdarticle21

Journal of Neuroscience Methods95(2000)65–73Quantification of GABA A receptor subunit mRNAs bynon-radioisotopic competitive RT-PCR utilizing plate-basedEIA methodologyMikko Uusi-Oukari a,Raymonde Kleinz c,Riikka Ma¨kela¨b,Hartmut Lu¨ddens c,Esa R.Korpi a,*a Department of Pharmacology and Clinical Pharmacology,Uni6ersity of Turku,Kiinamyllynkatu10,FIN-20520Turku,Finlandb Department of Mental Health and Alcohol Research,National Public Health Institute,Helsinki,Finlandc Department of Psychiatry,Clinical Research Group,Uni6ersity of Mainz,Mainz,GermanyReceived21June1999;received in revised form29September1999;accepted10October1999AbstractWe developed a non-radioisotopic quantitative competitive RT-PCR method for the measurement of g-aminobutyric acid (GABA)type A receptor subunit mRNA levels.The specificity of the method was optimized by the use of four subunit-specific oligonucleotides in the sequential steps:reverse transcription,polymerase chain reaction(PCR),and detection.The biotinylated PCR products were bound on streptavidin-coated microtiter plates allowing detection of the products using dinitrophenyl (DNP)-labeled probes and anti-DNP alkaline phosphatase conjugate.The method was set up for the six major cerebellar GABA A receptor subunits:a1;a6;b2;b3;g2and d.The method is quantitative and rapid.With a large dynamic range from10fg to1 ng of subunit mRNA,the accuracy was12and19%(intra-and interassay coefficients of variation,respectively),which might be improved by using a smaller range of standards.The use of a double logarithmic standard curve[log(standard to competitor signal)vs.log(standard mRNA originally present)]requires only one reaction from each sample,allowing the analysis of a large number of samples in one experiment.©2000Elsevier Science B.V.All rights reserved.Keywords:Quantitative RT-PCR;Competitive PCR;Non-radioisotopic;mRNA;GABA A receptor subunits/locate/jneumeth1.IntroductionDuring the last decade the development of quantita-tive reverse transcription polymerase chain reaction (qRT-PCR)has made it possible to accurately quantify low concentrations of specific mRNA species.As com-pared with other methods(i.e.Northern blot,dot blot, hybridization protection assays and in situ hybridiza-tion)the sensitivity of qRT-PCR is many orders of magnitude higher,allowing the quantification of only a few copies of a specific mRNA species in a sample;e.g.a sample constituting a single cell(Zimmerman and Mannhalter,1996;Freeman et al.,1999).Three basic RT-PCR quantification strategies have been developed [competitive,noncompetitive and kinetic(real-time)], each of them having different advantages and draw-backs(Freeman et al.,1999).The expression of subunit mRNAs for g-aminobu-tyric acid A(GABA A)receptor,the main inhibitory re-ceptor family in the central nervous system(CNS),is differentially affected by chronic administration of drugs modulating the receptor function,like benzodi-azepines,barbiturates and ethanol(Morrow,1995).The receptor subunits are encoded by at least17genes belonging to the following classes:a;b;g;d;o and r (Whiting et al.,1995;Barnard et al.,1998).The follow-ing mammalian subunit variants have been cloned: a1–6;b1–3;g1–3;d;o and r1–3(Whiting et al.,1995;Abbre6iations:RT,reverse transcription;PCR,polymerase chainreaction;qRT-PCR,quantitative RT-PCR;GABA,g-aminobutyricacid;EIA,enzyme immunoassay;ANT,alcohol-nontolerant(alcohol-sensitive);AT,alcohol-tolerant(alcohol-insensitive);DNP,dinitro-phenyl;std,standard;comp,competitor.*Corresponding author.Tel.:+358-2-3337542;fax:+358-2-3337216.E-mail address:esa.korpi@utu.fi(E.R.Korpi)0165-0270/00/$-see front matter©2000Elsevier Science B.V.All rights reserved. PII:S0165-0270(99)00158-2M.Uusi-Oukari et al./Journal of Neuroscience Methods95(2000)65–73 66Barnard et al.,1998).The receptor subunit composition largely determines a pharmacological profile for a re-ceptor.To study the effects of chronic treatments on GABA A receptor expression at transcriptional level,the use of qRT-PCR would be the method of choice for quantification of absolute amounts of subunit mRNAs. Thus far,only one method for quantification of abso-lute amounts of rodent GABA A receptor subunit mRNAs has been published(Grayson et al.,1993).The method has been used by several groups(Bovolin et al., 1992;Devaud et al.,1995).Here we describe the development of a competitive qRT-PCR method for the quantification of rat and mouse GABA A receptor subunit mRNAs.The principle of the method is outlined in Fig.1.Biotin–streptavidin interaction was used to enable quantification on micro titer plates.The use of radioisotopes is avoided by using hapten-labeled detection probes and an enzyme immunoassay methodology.We use a standard curve derived from RT-PCR amplification of a dilution seriesof wild-type RNA in the presence of afixed amount ofmodified competitor RNA(Tsai and Wiltbank,1996).By that approach only a single RT-PCR reaction isneeded from each sample.In order to measure GABA A receptor subunitmRNA levels in the cerebral cortex and cerebellum oftwo rat lines,alcohol non-tolerant(ANT)and alcoholtolerant(AT),which are selectively outbred for highand low sensitivity for ethanol-induced motor-impair-ment,respectively(Eriksson and Rusi,1981),we set upthe method with the major cerebellar subunits a1,a6, b2,b3,g2and d.As the GABA A receptor pharmacol-ogy is altered in the cerebellum of ANT rats(Uusi-Oukari and Korpi,1990;Korpi et al.,1993),we studiedwhether the alterations could be due to an alteredsubunit mRNA expression causing an altered receptorsubunit composition and thus deviant pharmacologicalfeatures.2.Materials and methods2.1.MaterialsThe cDNAs encoding for rat GABA A receptor sub-units a1,a6,b2,b3,g2S,g2L and d(accession numbersL08490,L08495,X15467,X15468,L08497and L08496,respectively)were under the cytomegaloviruspromoter in the pRK5plasmid(Shivers et al.,1989;Ymer et al.,1989;Lu¨ddens et al.,1990).RiboMAXRNA synthesis kit,Access RT-PCR kit,RNasin ri-bonuclease inhibitor and DNase I were from Promega(Madison,WI).Streptavidin-coated microtiter plateswere from Labsystems(Helsinki,Finland).All oligonu-cleotides were synthesized in the Institute ofBiotechnology,Helsinki,Finland.Dinitrophenyl(DNP)-modified oligonucleotides were synthesized us-ing DNP–phosphoramidite according to manufactur-er’s instructions(Cruachem,Glasgow,Scotland).Anti-DNP–alkaline phosphatase conjugate was pur-chased from Vector Laboratories(Burlingame,CA).DNA modifying enzymes were purchased fromPromega and New England Biolabs(Beverly,MA).p-Nitrophenyl phosphate(p NPP)and glycogen werefrom Boehringer Mannheim(Mannheim,Germany).2.2.AnimalsAdult male ANT and AT rats,developed by selectiveoutbreeding for high and low sensitivity to motor-im-pairing effects of a moderate dose of ethanol(2g/kg,intraperitoneally)(Eriksson and Rusi,1981),from theF56generation were maintained in groups of four to sixanimals in stainless steel wire cages under a12/12-hFig.1.Principle of the qRT-PCR assay.Total RNA samples and subunit-specific standard RNAs are reverse transcribed(RT)in the presence of subunit-specific competitor RNA to single-stranded cDNAs.The cDNAs are amplified by PCR.Biotinylated(B-)PCR products are bound to streptavidin(SA)-coated microtiter plates. Double-stranded DNA is made single-stranded by alkaline denatura-tion.Subunit-specific wild-type and competitor(black areas)se-quences are probed with selective dinitrophenyl(DNP)-modified probes.These hybrids are detected by anti-DNP alkaline phosphatase (AP)conjugate and quantified using p-nitrophenyl phosphate as a color-forming substrate for the enzyme.M.Uusi-Oukari et al./Journal of Neuroscience Methods95(2000)65–7367light/dark cycle(lights on at06:00h)at an ambienttemperature of2292°C and a relative humidity of5595%.The rats had free access to RM1E rodentfeed(SDS,Witham,UK)and tap water.The ratswere killed by decapitation,and cerebral cortices andcerebella were rapidly dissected out,frozen on dry iceand stored at−80°C.2.3.Criteria used for choosing subunit-specificsequences to be amplifiedSpecific PCR primers for each subunit identical inmouse and rat sequences were chosen to make themethod applicable for quantification of mRNAs ofboth species.Initial comparison of the cDNA se-quences was made using DNASIS6.0program(HitachiSoftware Engineering,Brisbane,CA)and a word pro-cessor(Boswell,1987).The specificity of the prelimi-nary primers were assessed by the OLIGSCAN program(Montpetit et al.,1992)and further analysed by the OLIGO 5.0program(Rychlik and Rhoads,1989)to prevent cross-reaction(3%dimer formation)of theprimers.Melting temperatures[T d,determined accord-ing to the nearest-neighbor method,see Rychlik andRhoads(1989)]of the primers were adjusted to simi-lar values for multiplex PCR, e.g.for single-cells.Primer sequences,T d values and length of the PCRproducts are listed in Table 1.Each5%primer was5%-biotinylated to allow the binding of PCR productson streptavidin-coated microtiter plates.2.4.Construction of subunit-specific competitors forcompetiti6e PCROverlapping PCR primers were used to generate amodified sequence in the wild-type subunit cDNAs(Ho et al.,1989).The modified sequence was intro-duced in the middle of the PCR product to be am-plified by RT-PCR.It replaced the sequence which isused for detection of wild-type sequence of the sub-unit(Table1).The sequence5%-CTC TTA AGAATG TTC AGT TTT AAA was used for competitorsof all subunits.Wild-type cDNAs of the subunitswere cut out from pRK5vectors and replaced by thecorresponding competitor cDNAs.This ensures theidentity of these two constructs with the exception ofthe modified24nucleotide fragment and minimizesvariability in PCR efficiency.2.5.Synthesis of standard and competitor RNAstandardsStandard(std)and competitor(comp)RNA foreach subunit were synthesized from linearized pRK5plasmids with SP6RNA polymerase using Promega’sRiboMAX kit according to manufacturer’s instruc-tions.After purification,the synthesized RNAs were DNase I digested,phenol/chloroform extracted,pre-cipitated with isopropanol,washed with70%ethanol, and resuspended in nuclease-free water containing RNasin(0.5U/m l).RNA concentrations were deter-mined spectrophotometrically at A260and the integrity of the RNA standards was verified by formaldehyde gel electrophoresis and ethidium bromide staining. The synthesized RNAs were diluted in nuclease-free water containing RNasin(0.1U/m l)and glycogen(0.1 m g/m l)to afinal concentration of0.1m g/m l,aliquotted and stored at−80°C.2.6.Purification of total RNATotal RNA from rat and mouse brain regions was purified using the acid guanidinium thiocyanate/phe-nol/chloroform extraction method(Chomczynski and Sacchi,1987).The purified samples were treated with DNase I for1h at37°C,phenol/chloroform ex-tracted,precipitated with isopropanol,washed with 70%ethanol and resuspended in nuclease-free water containing RNasin(0.5U/m l)and glycogen(0.1m g/ m l).Total RNA concentrations were determined spec-trophotometrically at A260and adjusted to0.5m g/m l. Samples that were purified without DNase I diges-tion and PCR-amplified without RT reaction gave signals over background indicating the presence of contaminating genomic DNA.DNase I digestion abolished these signals and was thus used in the purification procedure.2.7.Re6erse transcriptionReverse transcription(RT)was performed using Promega’s Access RT-PCR kit essentially according to manufacturer’s instructions except that RT and PCR reactions were performed separately.RT reac-tions were carried out in a total volume of20m l containing1×reaction buffer,0.1m M subunit spe-cific RT-primer(see Table1),1pg of subunit-specific competitor,5U AMV reverse transcriptase (Promega),2.5–8.75mM Mg2+depending on the op-timal Mg2+concentration of the subunit in PCR, and0.5mM dNTPs in the absence or presence of sample total RNA(1m g in most experiments).Vari-ous amounts of subunit-specific standard RNA(10–106fg at1log intervals)were RT-PCR amplified in the presence of1pg of competitor in parallel to pro-duce a standard curve.The tubes were incubated in a Perkin–Elmer9600thermal cycler for45min at 48°C.AMV reverse transcriptase was then inactivated by a2-min incubation at94°C followed by cooling the samples to4°C.M .Uusi -Oukari et al ./Journal of Neuroscience Methods 95(2000)65–7368Table 1Primers used for reverse transcription and PCR amplification of GABA A receptor subunit mRNAsT d (°C)Position in cDNA PCR product length (bp)RT primers58.61218–1237a 1RT 5%TAAAGGTTTTCTTGGGTTCT 56.91215–12325%ATGGCTGGTAAGAGCAAT a 6RT 5%GGATGGTGATTTTCAGTT b 2RT 53.51303–132052.71308–13255%AGATCAGGGATTTTGATT b 3RT 5%TGCCATCCAAACACTCAT g 2RT 58.31214–1231d RT 58.85%TGTCGATGGTGTCTGCAT1259–1276PCR primers 5%a 171.25%GCAACCAGCTATACCCCTAACTTAGC 1111–1136893%a 171.45%TTGACTTCTTTCGGTTCTATGGTCG 1175–119968.7997–10215%GCTGTCAACTACTTCACCAATCTCC 1685%a 65%GCTGGCCTCAGAAGATGGAACG 3%a 673.01143–116471.91167–11895%b 21175%CAGGAGCACAATGCTTGCCTATG 69.71261–12835%CGACTTTTCTTTTGTGCCACATG 3%b 25%GAATGAGGTTGCAGGCAGCG 5%b 371.01134–11531403%b 372.05%TCTTGTGCGGGATGCTTCTGTC 1252–127371.01084–11075%CGGAAACCAAGCAAGGATAAAGAC 125(g 2S)5%g 25%TATTCTTCATCCCTCTCTTGAAGGTG 3%g 269.91183–1208149(g 2L)5%d 69.85%GGAAAGCCAAGGTCAAGGTCAC 1022–104317670.41236–12575%GATGGGTTTGAGTCTGGAACGG 3%d DNP –labeled detection probes a 15%GCCAAGCCGGGGTCACC 1141–11571075–10885%TGCACAACAATCTC a 65%AAAACTATGCCTAGGCA b 21223–12395%TTTCCTATACTGGATTCCTGAGTT b 31189–12121114–11375%AATGGTAGGGGCAGGGTTTTTCTT g 2S 24nt exon between 5%CTTGAAGGAAAACATCCGAAGAAG g 2L 1125and1126in g 2S 1135–1152d 5%AGGGACCCGGCCTTGACGcomp a5%TTTAAAACTGAACATTCTTAAGAG Position of modified sequence in subunit -specific competitors 1144–1167a 1a 61063–1086b 21213–12361189–1212b 3g 21114–1137d1129–1152aThe detection sequence of subunit-specific competitors (comp)is the same for all subunits.Therefore,comp probe was used to detect subunit-specific competitors of all subunits.2.8.PCR amplification of the cDNAsAfter the RT reaction the subunit-specific PCR primers and 5U TflDNA polymerase (Promega)were added in 1×reaction buffer in a total volume of 30m l.The final concentrations in the 50m l incubation volume were:0.1m M PCR primers,0.2mM dNTPs and 1.0–3.5mM Mg 2+depending on the optimal Mg 2+concentration for each subunit.PCR was performed in Perkin Elmer 9600thermal cycler.Following an initial 2-min denaturation at 94°C the cycling conditions were set as follows:94°C for 30s (denaturation),65°C for 30s (annealing)and 68°C for 30s (extension).A total of 25cycles was performed followed by a final extension at 68°C for 10min and cooling to 4°C.2.9.Detection of amplified sequencesAfter PCR,45m l of each PCR sample were diluted with 200m l of binding buffer (BB;20mM Tris–HCl,pH 7.5,containing 5mM EDTA,250mM NaCl,0.2%polyvinyl pyrrolidone,0.2%Ficoll 400and 0.05%Tween 20).Four 50-m l aliquots of the diluted sample were applied into four separate streptavidin-coated mi-crotiter plate wells:two wells to be hybridized with DNP-labeled wild-type subunit-specific detection probe and two wells to be hybridized with DNP-labeled detec-tion probe specific for the competitor sequence.The plates were incubated at room temperature for 30min with shaking,followed by addition of 100m l of denaturation solution (0.1M NaOH /0.3M NaCl).The plates were shaken for 1min and washed three timesM.Uusi-Oukari et al./Journal of Neuroscience Methods95(2000)65–7369with washing buffer(WB;20mM Tris–HCl,pH7.5, containing150mM NaCl and0.05%Tween20)using an automated Wallac1296–024Delfia Platewash plate washer.As the g2S and g2L splice variants were quantified separately,each PCR sample was diluted with300m l of BB.Six50-m l aliquots of each diluted PCR sample were bound to microtiter plates wells,two wells to be hybridized with each of the three detection probes:g2S; g2L and competitor.The wild-type subunit-and competitor-specific detection probe diluted in BB was added at30nM in a total volume of50m l/well and the plates were incubated for1h at room temperature with shaking.Some of the wild-type probes exhibited cross-reactivity either to the corresponding amplified competitor sequence or to the biotinylated5%PCR primer.Therefore,various incubation temperatures were tested to eliminate this nonspecific hybridization.Following hybridization,the plates were always washed at the hybridization temperature.After hybridization,the plates were washed six times with WB.Then50m l anti-DNP alkaline phosphatase conjugate diluted1:3000in conjugate buffer(CB;20 mM Tris–HCl,pH7.5,containing150mM NaCl,2 mM MgCl2,0.05%Tween20,1%BSA)was added.The plates were incubated at room temperature for1h and subsequently washed six times with WB.p-Nitrophenyl phosphate in substrate buffer(1M diethanolamine,pH 9.8,containing0.5mM MgCl2)was then added to each well(4mg/ml,100m l/well).The plates were incubated at room temperature with shaking and the OD405was read at various time points using a Multiscan Plus plate reader(Labsystems,Helsinki,Finland).2.10.Data analysisThe standard curves were produced by competitive coamplification of various amounts(10–106fg)of wild-type standard RNA with afixed amount of competitor RNA(1pg).Values for log(signal of standard/signal of competitor)were calculated and plotted against log (initial amount of standard RNA).The PRISM2.0pro-gram(GRAPHPAD Software,San Diego,CA)was used to generate the standard curve by linear regression and to calculate the amount of subunit mRNAs in the samples.Statistical differences between two groups were assessed using Student’s t-test,the P values smaller than0.05were regarded statistically significant.3.Results3.1.Optimization of PCR conditionsInitial RT-PCR experiments using1m g of cerebral cortical or cerebellar total RNA and40PCR cyclesyielded only one band of the expected size for allsubunits when analyzed in agarose gel electrophoresis.Therefore,the annealing temperature of65°C was highenough for specific amplification of the subunits.Optimal Mg2+concentrations for the subunit/primercombinations in PCR were assessed in Mg2+concen-tration range of1.0–3.5mM.One pg of each standardor competitor RNA was used as a template.The opti-mal Mg2+concentrations(in mM)were2.0–3.0(a1),2.5–3.5(a1comp),2.0–3.5(a6),3.0(b2),1.5–3.5(b3),2.5–3.0(g2S and g2L)and1.0–3.0(d).The optimalrange for Mg2+concentration was the same for thestandard and competitor for subunits other than a1.3.2.Optimization of hybridization conditionsInitial hybridization experiments were done at roomtemperature.PCR primers for a given subunit(1pmolof primers/well)or RT-PCR products from the corre-sponding standard or competitor template(productsfrom two50-m l RT-PCR reactions with100pg templatewere pooled and divided in three wells)were bound tomicrotiter plate wells.Nonbiotinylated DNA strandswere eluted and the corresponding probes added at30nM concentration.The subsequent washings and incu-bations were performed as described in Section2.Thewild-type probes for a1,a6,b2,b3and g2L subunitsgave no background and did not hybridize to biotiny-lated PCR primer or to the corresponding competitorRT-PCR products.The competitor probe did not cross-hybridize with any of the biotinylated PCR primers orstandard-specific RT-PCR products from any subunit.The probes for g2S and d showed cross-hybridizationto other targets than their complementary sequences inRT-PCR products from standard RNAs.Hybridizationof the d probe with primers and RT-PCR productsfrom the d competitor template gave40and10%of thesignals,respectively,as compared with the signal fromhybridization with standard RT-PCR products,indicat-ing significant cross-hybridization of the probe.Elevating the hybridization and subsequent wash tem-peratures to45°C reduced the cross-reactions to back-ground level without affecting hybridization to thestandard RT-PCR product.The24nt probe used for the detection of the g2Ssubunit is complementary to12nt of both5%and3%sequencesflanking the24nt sequences that are used fordetection of g2L and g2competitor.As expected,the g2S probe cross-reacted with the g2L-and g2competi-tor RT-PCR products at room temperature.Incubationand subsequent washing at60°C was needed to reducethese signals to background level.This temperature didnot affect the level of g2S probe hybridization to RT-PCR product derived from g2S template.M .Uusi -Oukari et al ./Journal of Neuroscience Methods 95(2000)65–7370amplification efficiencies of a 1standard and a 1com-petitor templates were evaluated by amplifying 1pg of both targets for various number of cycles.The slopes for the signal intensities plotted against the number of cycles did not differ between the two targets (Fig.2).Furthermore,the a 1standard /a 1competitor signal ra-tio after different number of PCR cycles did not differ from each other (cycles 18–25,mean 9S.E.M.=0.96990.005),indicating identical amplification effi-ciencies of the two templates.3.4.Effect of total RNA on amplification efficiencyThe expression of the a 6subunit is restricted to the cerebellar granule cells and cochlear nuclear granule cells (Lu ¨ddens et al.,1990;Varecka et al.,1994).There-fore,we used cerebral cortical total RNA and a 6RNA standards to assess whether the presence of total RNA might affect the amplification efficiency of RNA stan-dards differently or affect the slope of log(std /comp)to log(initial amount of std RNA before RT-PCR)stan-dard curve.The standard curves in the absence and presence of cerebral cortical total RNA were very simi-lar (Fig.3):the slopes of the curves were 5.690.3(no RNA)and 5.490.3(with RNA).Therefore,non-spe-cific RNA does not alter the standard curve indicating its suitability in evaluating the amount of mRNA cod-ing for a subunit in total RNA sample to be quantified.The linearity of the method was further evaluated by measuring the amount of endogenous a 1mRNA in cerebral cortical total RNA serially diluted in DEPC-treated water (Fig.4).The slope values for a 1standard curve (4.890.5)and endogenous a 1mRNA in serially diluted cortical total RNA (4.790.3)did not signifi-cantly differ from each other.Therefore,the standard and sample a 1RNA are amplified with the same effi-ciency,and the non-specific RNA has no effect on the amplification.The linearity in serially diluted cerebellar total RNA was demonstrated for a 6and b 2as well (data not shown).3.5.Reproducibility of the assayThe coefficient of variation (CV)was calculated within and between assays for quantification of a 1mRNA from cortical total RNA.The intra-and in-terassay CVs were 12%(n =10)and 19%(n =4),respectively.3.6.Quantification of subunit mRNAs in brain total RNA samples of AT and ANT ratsGABA A receptor subunit mRNAs were quantified in cerebral cortical and cerebellar total RNA from ANT and AT rats.The mRNA levels of a 1,b 2and b 3Fig.2.Amplification rates of a 1standard and a 1competitor.Sam-ples containing 1pg of a 1standard ( )and 1pg ( )a 1competitor were reverse transcribed and amplified for the number of cycles indicated.After the PCR,the products were quantified as described in Section 2.The values represent mean 9S.E.M.of three reactions.Fig.3.Effect of cortical total RNA on the RT-PCR amplification of the a 6standard.Various amounts (10fg–1ng)of a 6standard were amplified with 1pg of a 6competitor in the absence ( )and presence ( )of cerebral cortical total RNA (1m g /tube).Log (a 6std /a 6comp)was plotted against the log (amount of initial std RNA added to the RT-PCR).The values represent means of three PCR reactions.3.3.Validation of the method3.3.1.Amplification efficiencyThe optimal Mg 2+concentration for amplification of each standard and competitor template by RT-PCR was the same for both variants of the subunit.To further characterize the behavior of the templates,theM.Uusi-Oukari et al./Journal of Neuroscience Methods95(2000)65–7371Fig.4.Quantification of a1mRNA from serially diluted cerebral cortical RNA.The undiluted sample contained2m g of total RNA, and a serial1:10dilution was made in DEPC-treated water.These samples( )were RT-PCR amplified in parallel with the samples for the a1standard curve( ).The values represent means of three PCR reactions.statistically significant differences between the rat lines in mRNA levels of the subunits quantified in these two brain regions(Table2).4.DiscussionWe describe here the procedure and validation of a competitive qRT-PCR method for GABA A receptor subunit mRNAs,starting with the major cerebellar subunits.The method is strictly subunit-specific at each step:subunit-specific primers in the RT reaction,the amplification performed with subunit-specific primers, and the PCR productsfinally detected with subunit-specific detection probes.The method was shown to be highly specific for the subunit to be quantified;all primers amplified only one band of the correct size from total brain RNA samples.Furthermore,the cere-bellar granule-cell specific a6mRNA was not detected from cerebral cortex.Nonspecific RNA was without an effect on quantitative RT-amplification.The method offers many advantages as compared with‘conventional’qRT-PCR,where samples are am-plified in the presence of various amounts of competitor RNA,and the products quantified following restriction enzyme digestion and separation using agarose gel elec-trophoresis:(1)only one RT-PCR reaction is needed for each sample,and therefore less RNA sample is needed allowing the analysis of large number of sam-ples;(2)no hazardous and expensive radioisotopes are used;(3)heteroduplex formation is not a problem (Henley et al.,1996),as single-stranded PCR-products are detected;(4)the quantification of PCR products on microtiter plates is rapid,making it possible to quantify several hundred samples during1working day. Twenty-five cycles were sufficient to amplify all sub-units.If a more sensitive method is needed,for example in single-cell RT-PCR,it is possible to use lower stan-dard and competitor concentrations and higher cycle number to quantitate lower mRNA concentrations. The relative amounts of different GABA A receptor subunits in the cerebral cortex and cerebellum are in accordance with earlier qRT-PCR studies(Bovolin et al.,1992;Devaud et al.,1995,1996).Of the subunits studied,the concentrations of a1and b3in cerebral cortex were the highest,while that of g2variants and d were the lowest(Table2,Devaud et al.,1995,1996). However,in the present study the concentrations were five to tenfold lower than those found by Devaud et al. (1995,1996).The reason for this difference remains unresolved:differences in spectrophotometrical quan-tification of the RNA standards would cause a differ-ence in the levels,but are unlikely to cause such a large difference between the two methods.The use of a double log scale for quantification by competitive RT-PCR may also reduce the quantitative realibility of theTable2Quantification of subunit mRNAs from cerebral cortical and cerebel-lar samples of ANT and AT rats aRat strainSubunit mRNA concentration(pg/m g of total RNA)Cerebral cortex Cerebellum ANTa18.7790.607.1490.58 AT7.6590.329.4090.87ANTa6090 3.0890.30 AT090 3.5790.88ANT7.8690.59b28.1190.669.3091.008.7090.89ATANT10.990.64b3 6.7690.38 AT11.790.83 5.7390.460.4990.040.8090.05g2S ANTAT0.8090.070.5690.031.5890.13g2L ANT 2.2890.18AT 2.9890.18 1.7090.13d 1.7790.261.3290.08ANT1.2190.04AT 1.7190.20a The subunit mRNA levels in total RNA purified from cerebral cortex and cerebellum were quantified as described in Section2.The values represent mean9S.E.M.of seven(ANT)and six(AT)ani-mals.subunits were the highest in both cerebral cortex and cerebellum(Table2).No a6mRNA was detected in cerebral cortex from either rat line.There were no。