MT 1 2 gene expression in the human prostate

The Prostate 43:125–135 (2000)Metallothionein Isoform 1 and 2 Gene Expression in the Human Prostate: Downregulation of MT-1X in Advanced Prostate CancerScott H. Garrett, Mary Ann Sens, Deepti Shukla, Luis Flores, Seema Somji, John H. Todd, and Donald A. Sens* Robert C. Byrd Health Sciences Center, Departments of Pathology and Urology, West Virginia University, Morgantown, West VirginiaBACKGROUND. Studies have shown an association of metallothionein (MT) overexpression with tumor type and grade. However, a family of genes underlies the expression of these proteins. The goals of this study were to define the expression of MT genes and protein in normal human prostate and to provide evidence that the expression of the MT isoforms is altered in prostate cancer. METHODS. Immunohistochemistry was used to localize MT protein, reverse transcriptionpolymerase chain reaction (RT-PCR) to determine the MT isoform-specific mRNAs, and immunoblot analysis to determine MT protein levels. RESULTS. The localization of MT in the prostate was further defined using the E9 antibody. Using normal prostate tissue dissected from glands removed for prostate cancer, it was demonstrated that MT protein expression in the normal prostate is supported by mRNA from the MT-1A, MT-1E, MT-1X, and MT-2A genes. No expression of the MT-1X gene was demonstrated in cases of advanced prostate cancer. The expression of MT-1 and MT-2 isoformspecific mRNA varied among three commonly utilized prostate cancer cell lines. CONCLUSIONS. MT protein in the normal human prostate is supported by transcription of mRNA from the MT-1A, MT-1E, MT-1X, and MT-2A genes. Expression of MT-1X mRNA is downregulated in advanced prostate cancer. Variable expression of MT mRNA in prostate cell lines provides evidence that MT gene expression may be altered among individual prostate cancers. Prostate 43:125–135, 2000. © 2000 Wiley-Liss, Inc. KEY WORDS: metallothionein; immunohistochemistry; RT-PCR; cell culture; PIN; prostate cancer; mRNA; prostateINTRODUCTION The metallothioneins (MTs) are a family of low molecular weight, cysteine-rich intracellular proteins that bind transition metals, including Cu+2, Zn+2, Ag+2, Hg+2, and Cd+2 [1]. Most studies have centered on the analysis of two major isoforms of MT (designated MT-1 and MT-2) that were identified through ionexchange chromatography [1,2]. The MT-1 and MT-2 isoforms have been proposed to play a role in metal detoxification (Cd+2, Hg+2, Ag+2, and Pb+2), in essential metal homeostasis (Zn+2 and Cu+2), and in the protection of cells against damage induced by alkylating agents, oxygen radicals, and ionizing radiation © 2000 Wiley-Liss, Inc.[3]. Furthermore, the MT-1 and MT-2 isoforms have been shown in numerous animal and human tissues and derived cell lines to be highly inducible by these metals and by a variety of other chemicals and stimuli [1–3]. Genes for two other charge-separable MT isoforms with restricted tissue distribution, MT-3 and MT-4, were recently described [4,5]. Recently, it was also demonstrated that antibodies are available that*Correspondence to: Don Sens, Ph.D., Department of Pathology, West Virginia University, P.O. Box 9203, Morgantown, WV 26506. E-mail: dsens@ Received 8 June 1999; Accepted 10 December 1999126Garrett et al. mens were obtained from radical prostatectomies removed due to primary prostate cancer. The control specimens were obtained from areas well removed from the tumor, as determined by the pathologist. The normal specimens included sampling from the peripheral, transitional, and central zones of the prostate. All specimens were obtained following completion of diagnostic protocols in surgical pathology; the protocol for tissue acquisition was approved by our Institutional Review Board for Human Research. Only samples showing no evidence of tissue degradation, as judged by histochemical examination of hematoxylin and eosin-stained sections, were used for molecular analysis. For the immunohistochemical analysis of MT-1 and MT-2 expression, paraffin blocks of prostate specimens were obtained from the pathology archives. For the determination of MT-1 and MT-2 isoformspecific gene expression in prostate cancer, paraffin blocks from 5 cases of advanced cancer were selected from the pathology archives. Case 1 is a poorly differentiated adenocarcinoma (Gleasons 5 + 5) from a 69year-old male. Case 2 is a moderately differentiated adenocarcinoma (Gleasons 3 + 4) from a 69-year-old male. Case 3 is a moderately differentiated adenocarcinoma (Gleasons 3 + 2) from a 73-year-old male. Case 4 is a poorly differentiated adenocarcinoma (Gleasons 4 + 5) from a 64-year-old male. Case 5 is a moderately differentiated adenocarcinoma (Gleasons 2 + 3) from a 74-year-old male. Cell Culture The cell lines used in this study were obtained from the American Type Culture Collection (Rockville, MD) with corresponding designations: Du-145 (HTB 81), LNCaP (CRL 1740), and PC-3 (CRL 1435). The cells were grown in Ham’s F-12 or RPMI medium supplemented with 10% (v/v) fetal calf serum. The cells were passaged at a 1:4 ratio upon attaining confluence. RNA Isolation and RT-PCR From Fresh Tissues and Cell Lines Prostate tissue was ground to a powder under liquid nitrogen. The human prostate cancer cell lines were grown to confluence in 75-cm2 T-flasks. Total RNA was isolated from the cultured cells and powdered tissue according to the protocol supplied with TRI REAGENT™ (Molecular Research Center, Inc., Cincinnati, OH), as described previously [11,12]. The concentration and purity of the RNA samples were determined using a spectrophotometer scan in the ultraviolet (UV) region and ethidium bromide (EtBr) visualization of intact 18S and 28S RNA bands following agarose gel electrophoresis. Total RNA (0.5 ␮g) wascan be used to immunohistochemically determine the coexpression of MT-1 and MT-2 protein in archival paraffin-embedded tissues. This has allowed the retrospective analysis of MT overexpression status in a wide variety of human tumors (review in Jasani and Schmid [6]). Overall, these studies have shown an association of MT overexpression with the type and grade of tumor [6]. In the normal human prostate, both immunohistochemistry and radioimmunoassay have been employed to determine the expression of MT-1 and MT-2 proteins [7]. MT immunoreactivity was localized in the cytoplasm and nucleus of glandular epithelial cells. In general, the immunoreactivity of MT was most intense in the peripheral zone, moderate in the transitional zone, and weak in the central zone; however, epithelial cells in all zones showed a large variability in MT staining intensity. In prostate cancer, MT was detected in 15 of 45 cases of primary cancer [8]. When immunoreactive, MT was localized to both the cytoplasm and nucleus. The expression of MT was correlated to tumor grade, with significant differences between high and low Gleason scores, and between middle and low Gleason scores, but no relationship was found with clinical stage. It was concluded that there was a close correlation of MT expression with tumor grade and that MT has a wide range of expression in prostate cancer. However, what is not widely appreciated when assessing and interpreting the immunoreactivity of the MT-1 and MT-2 proteins, is that a family of genes underlies the expression of these proteins. In humans, the MTs are encoded by a family of genes located at 16q13 consisting of 10 functional (MT-1A, MT-1B, MT-1E, MT-1F, MT-1G, MT-1H, MT1X, MT-2A, MT-3, and MT-4) and 7 nonfunctional (MT-1C, MT-1D, MT-1I, MT-1J, MT-1K, MT-1L, and MT-2B) MT isoforms [4,5,9,10]. This raises the possibility that the clinical significance of MT expression in human prostate cancer might be further defined if specific MT gene expression patterns were known for both normal and cancerous tissue. The first goal of this study was to confirm the expression of MT in the normal prostate and then to define the expression of the active MT-1 and MT-2 genes underlying this MT immunoreactivity. An additional goal was to provide initial evidence, using advanced cases of prostate cancer and prostatic cell lines, that the expression of the MT isoforms might vary among individual cancers. MATERIALS AND METHODS Prostate Specimens for Immunohistochemical and Molecular Analysis For the determination of MT-1 and MT-2 isoform gene expression in normal prostates, six control speci-MT Gene Expression in Human Prostate reverse-transcribed using murine leukemia virus (MuLV) reverse transcriptase (50 units) in 1 × PCR buffer (50 mM KCl and 10 mM Tris-HCl, pH 8.3), 5 mM MgCl2, 20 units RNase inhibitor, 1 mM each of the dNTPs, and 2.5 ␮M random hexanucleotide primers. The samples were reverse transcribed for 20 min at 42°C, followed by a 5-min denaturation step at 99°C using a DNA thermocycler (Perkin-Elmer-Cetus 9600, Perkin Elmer, Foster City, CA). The reversetranscribed product was used for PCR amplification using the AmpliTaq DNA polymerase enzyme (2.5 units) (Perkin Elmer) and the specific upstream and downstream primers at a concentration of 0.075 ␮M each. The primers developed for analysis of each of the active MT genes have been previously described [11,12]. The thermocycler was programmed to cycle at 95°C for a 2-min initial step, at 95°C for 30 sec, and at 68°C for 30 sec, with a final elongation step at 68°C for 7 min. Controls for each PCR included a no-template control where water was added instead of the RNA, and a no-reverse-transcriptase control where water was added instead of the enzyme. Samples were removed at 25, 30, 35, and 40 PCR cycles to ensure that the reaction remained in the linear region. The final PCR products were electrophoresed on 2% agarose gels containing EtBr along with DNA markers. The intensity (integrated optical density, IOD) of the PCR product bands was determined on a Roche Pathology workstation (Roche Image Analysis Systems, Inc., Elon College, NC) configured with Kontron KS 400 image analysis software (Zeiss, Thornwood, NY). RNA Isolation and RT-PCR of Microdissected Tissue From Paraffin Blocks The PixCell II™ LCM System (Arcturus Engineering, Mountain View, CA) was used for laser capture. Five-micron-thick sections were cut from formalinfixed, paraffin-embedded tissue blocks with a microtome and mounted on plain glass slides. The slides were stained with hematoxylin and eosin-y. Total RNA was extracted from samples using the micro RNA isolation kit (catalog no. 200344, Stratagene, La Jolla, CA). The captured tissue was placed in a reagent tube containing 200 ␮l of denaturing buffer and 1.6 ␮l of ␤-mercaptoethanol. The tube was inverted several times to digest the tissue from the cap. Twenty microliters of 2 M sodium acetate (pH 4.0) solution were added to the samples along with 220 ␮l of phenol and 60 ␮l of chloroform:isoamyl alcohol. The samples were vortexed and placed on ice for 15 min, followed by centrifugation at maximal speed in a microfuge for 30 min at 4°C to separate the aqueous and organic phase. The upper aqueous phase was transferred to a fresh tube, and 1 ␮l of glycogen (2 ␮g/␮l) was added. RNA127was precipitated with the addition of 200 ␮l of ice-cold isopropanol. The samples were left overnight in a −70°C freezer, after which they were centrifuged at maximal speed in a microfuge for 30 min at 4°C. The supernatant was removed and the RNA pellet was washed twice with 70% ethanol. The pellet was dried on ice and resuspended in RNase-free water. Total RNA (1 ␮l) was reverse transcribed in a 20 ␮l reaction mixture using MuLV reverse transcriptase (50 units) in 1 × PCR buffer (50 mM KCl and 10 mM Tris-HCl, pH 8.3), 5 mM MgCl2 solution, 20 units RNase inhibitor, 1 mM each of the dNTPs, and 2.5 ␮M random hexanucleotide primers. The samples were reverse-transcribed for 20 min at 42°C, followed by a 5-min step at 99°C to inactivate the reverse transcriptase using a GeneAmp 9600 thermocycler (PE Applied Biosystems, Foster City, CA). The resulting cDNA was amplified in a 100-␮l reaction mixture containing 2 mM MgCl2, 1 × PCR buffer, 2.5 units of AmpliTaq DNA polymerase, and 0.2 ␮M of the respective outer primers. The PCR was performed as follows: an initial incubation at 95°C for 2 min for a denaturation step, followed by 40 cycles of 95°C for 30 sec and 68°C for 30 sec. Controls for each PCR reaction included a notemplate control in which 1 ␮l water was added instead of the RNA, and a no-reverse-transcriptase control in which 1 ␮l of water was added instead of the enzyme. Twenty microliters of the product from the first-round of PCR were added to 80 ␮l of a PCR reaction mixture (2 mM MgCl2, 1 × PCR buffer, 200 ␮M dNTPs, 2.5 units of AmpliTaq DNA polymerase, and 0.2 ␮M of the respective inner nested primers) for a second round of PCR. Samples were removed at 30, 35, and 40 PCR cycles to ensure that the reaction remained in the linear region. The outer and inner nested primers for the human ␤-actin gene and MT isoforms were developed using Oligo 5.0 software (National Biosciences, Inc., Plymouth, MN). The upper outer and inner primer sequence for MT-1A and the lower outer and inner primer sequence for MT-1E were the same. The sequences of the outer and inner nested primers along with the product sizes are as follows: ␤-actin: outer primer upper 5Ј ATGGATGATGATATCGCCGCG 3Ј and lower 5Ј CTCCATGTCGTCCCAGTTGGT 3Ј (product size, 249 bp), nested inner primer upper 5Ј CGACAACGGCTCCGGCATGT 3Ј and lower 5Ј TGCCGTGCTCGATGGGGTACT 3Ј (product size, 194 bp); MT-1A outer primer upper 5Ј CTCGAAATGGACCCCAACT 3 Ј and lower 5 Ј ATATCTTCGAGCAGGGCTGTC 3Ј (product size, 219 bp), nested inner primer lower 5Ј TCTCTGATGCCGCTTTGC 3Ј (product size, 172 bp); MT-1E outer primer upper 5Ј GCTTGTTCGTCTCACTGGTG 3Ј and lower 5Ј CAGGTTGTGCAGGTTGTTCTA 3Ј (product size, 284 bp), nested inner primer upper 5Ј TTGCTC-128Garrett et al. has detection limits in the range of 0.1–0.5 ng MT-1/2 protein. Immunohistochemistry For immunohistological characterization, prostate specimens were obtained from pathology archives. These specimens were routinely fixed in neutralbuffered formalin for 16–18 hr. All tissues were transferred to 70% ethanol and dehydrated in 100% ethanol. Dehydrated tissues were cleared in xylene, infiltrated, and embedded in paraffin. Serial sections were cut at 3–5 ␮m for use in immunohistochemical protocols. Prior to immunostaining, sections were pretreated in a microwave at 700 W in 10 mM citrate buffer (pH 6.0) for 5 min. Sections were allowed to cool for 5 min at room temperature, were microwaved again for 5 min, and were slowly immersed into distilled water. MT was localized using a monoclonal mouse anti-horse MT-1, MT-2 antibody (DAKO-MT, E9, in 0.05M Tris/HCl, 15mM NaN3, pH 7.5, 1%BSA, DAKO Corp.) as the primary antibody. The primary anti-MT antibody was localized using the avidinbiotin-peroxidase complex (ABC) procedure (Vectastain Kit, Vector Laboratories), using diaminobenzidine for visualization (Stable DAB, Research Genetics, Huntsville, AL). Slides were rinsed in distilled water, dehydrated in graded ethanols, cleared in xylene, and coverslipped. The positive control was the demonstration of MT staining localized to the proximal tubule in human archival kidney specimens. The negative control consisted of omission of primary antibody from the immunohistochemical ABC sequence. RESULTS Immunohistochemical Localization of MT in the Human Prostate The first goal of the present study was to confirm the results of the only previous study to detail the expression of MT in the normal human prostate [7]. This earlier study employed a laboratory-generated MT antibody, while the present study used the commercially-available source of MT antibody (DAKO, E9) that has been used in the majority of studies detailing MT expression in human tumors [6]. The results of the present study demonstrated variable, punctate staining of MT-1/2 in the cytoplasm of the acinar cells with frequent nuclear profiles, particularly in the peripheral zone acini (Fig. 1A,B). Similar to the previous study, the MT staining was generally stronger in the peripheral zone than in prostatic glands in the central zone; however, there was considerable variation in staining, as was also noted in the previousGAAATGGACCC 3Ј (product size, 246 bp); MT-1X outer primer upper 5Ј TCTCCTTGCCTCGAAATGGAC 3Ј and lower 5Ј GGGCACACTTGGCACAGC 3Ј (product size, 151 bp), nested inner primer upper 5Ј TCGAAATGGACCCCAACT 3Ј and lower 5Ј CTTGGCACAGCCGACA 3Ј (product size, 134 bp); MT-2A outer primer upper 5Ј CCGACTCTAGCCGCCTCTT 3Ј and lower 5Ј GTGGAAGTCGCGTTCTTTACA 3Ј (product size, 259 bp), and nested inner primer upper 5Ј CCATGGATCCCAACTGCTC 3Ј and lower 5Ј TGGAAGTCGCGTTCTTTACAT 3Ј (product size, 232 bp). The final PCR products were electrophoresed on 2% a agarose gel containing ethidium bromide along with DNA markers (Gibco BRL, Grand Island, NY) to verify the size of PCR products. The intensity (integrated optical density, IOD) of the PCR product bands was determined on a Roche Pathology workstation configured with Kontron KS 400 image analysis software. MT Protein Determination Cells were washed twice with PBS and then lysed in buffer containing 50 mM of Tris (pH 6.8) with 2% wt/v SDS. Prostate tissue samples were homogenized in the same buffer. Protein concentration was determined by the BCA protein assay (Pierce Chemical Co., Rockford, IL). MT protein was detected by immunoblotting using a mouse anti-horse antibody (DAKOMT, E9, Dako, Carpinteria, CA) as the primary antibody [13,14]. This antibody detects both the MT-1 and MT-2 isoforms, and the product detected is referred to as MT-1/2 in this report. Aliquots of 3 ␮g total protein were diluted to 75 ␮l in buffer (10 mM Tris, pH 7.4, 75 mM NaCl) and mixed with 75 ␮l of 3% glutaraldehyde to enhance the detection of MT. One hundred microliters of this mixture (2 ␮g total protein) were applied to a dot-blot apparatus with a polyvinylidine difluoride membrane. Samples were allowed to flow through the apparatus by gravity, followed by two PBS washes. After blocking with 10% skim milk in PBS, the membrane was soaked in primary antibody (1:100 dilution, 1% bovine serum albumin (BSA) in PBS) for 2 hr. The membrane was washed three times with PBS before anti-mouse alkaline phosphataseconjugated secondary antibody (Promega, Madison, WI) was added (1:500 dilution, 0.4% BSA in PBS). Antibody complexes were visualized using the alkaline phosphatase kit III (Vector Laboratories, Burlingame, CA). Rabbit liver Cd/Zn metallothionein-1 (Sigma Chemical Co., St. Louis, MO) was applied to each blot to generate standard curves. MT-1/2 protein was quantified by comparing the optical density of the sample dots to that of the standard MT curve, using image analysis software (KS 400, Kontron). This assayMT Gene Expression in Human Prostate129Fig. 1. Immunohistochemical localization of MT-1/2 in the human prostate (1:200 antibody dilution). A: Moderate, variable punctate staining for MT is present in the cytoplasm of acinar cells in the peripheral zone and frequently in the nucleus of the lining acinar cells. No staining for MT was noted in the basal cell layer (magnification ×200). B: Variable staining in central zone acini, with less frequent nuclear staining. The basal cell layer stained more consistently in the central zone acini. The underlying compact muscular stromal cells demonstrated very weak or negative staining (magnification ×200). C: Strong staining of MT in areas of cystic atrophy (magnification ×400). D: High magnification of the epithelial cells in C highlights the punctate staining within the cytoplasm, with some nuclear profiles visible (magnification ×1,000, oil). E: Stromal cells in fibromuscular hyperplasia demonstrate moderate staining (magnification ×200). F: Areas of granulomatous prostatitis demonstrate strong MT staining in the inflammatory cells and stroma, and increased MT staining within adjacent prostatic glands (magnification ×100). G: Main prostatic duct, with strong MT staining in lining cells and weaker staining in underlying urothelial cells. Moderate staining of inflammatory cells within the underlying lamina is also seen (magnification ×200). H: Corpora amylacea were generally negative or demonstrated weak staining of the concentric laminations (magnification ×200).130Garrett et al.study. The MT-1/2 immunostaining in the peripheral zone had increased uniformity between cells, and more frequent nuclear profiles were seen within the acinar cells when compared to staining in the central zone acini. The immunostaining for MT-1/2 was generally stronger in adenomatous areas and in areas of cystic atrophy (Fig. 1C,D). The noncompact stroma of the peripheral zone was generally negative for MT staining, while very weak, occasional staining of the compact muscular stroma of the central zone was present. Increased staining for MT-1/2 was also noted in the stromal cells of fibromuscular hyperplasia (Fig. 1E) and in areas of granulomatous and chronic prostatitis (Fig. 1F). In areas of inflammation, the acini also tended to have increased immunostaining for MT-1/2. The epithelial cell lining of the major prostatic ducts generally had moderate to strong MT immunoreactivity, while the underlying urothelial epithelium demonstrated negative or weak reactivity (Fig. 1G). The corpora amylacea within prostate glands had negative or weak nonspecific staining of the concentric laminations (Fig. 1H). MT Isoform Gene Expression in the Human Prostate RT-PCR was utilized to determine which of the active MT-1 and MT-2 genes were expressed in the normal prostate, and the relative amounts of each were determined by comparison to the housekeeping genes, ␤-actin and glyceraldehyde 3-phosphate dehydrogenase (G3PDH). Examination of a typical gel profile obtained from RT-PCR analysis of total RNA from one clinical sample demonstrated expression of MT-1A, MT-1E, MT-1F, MT-1X, and MT-2A isoforms, while no expression of the MT-1B, MT-1G, and MT-1H isoforms was detected (Fig. 2). Assuming equal efficiencies of the PCR for each MT isoform, examination of the gel profiles also demonstrated that the MT-2A and MT-1X isoforms had the highest, and approximately equal, levels of expression when compared to the MT-1A, MT-1E, and MT-1F isoforms. The relative level of expression of the MT-2A and MT-1X isoforms approximated that of the G3PDH housekeeping gene, but was below that of the ␤-actin housekeeping gene (Fig. 2). An identical analysis of MT isoform-specific mRNA expression on total RNA from the other five samples of human prostate demonstrated very similar results (Table I). The only notable exception was that the MT1F isoform was only expressed in 1 of the 6 specimens. Determination of the MT-1/2 protein content of the six normal prostate specimens by immunoblot demonstrated a range of MT-1/2 expression that varied from a low of 2.97 ± 0.19 ng MT/␮g total protein to a high of 8.71 ± 0.13 ng MT/␮g total protein (Table I).Fig. 2. Basal MT gene expression determined by RT-PCR, using total RNA from a normal human prostate. Total RNA was purified from human prostate tissue and subjected to RT-PCR using primers specific for: G3PDH, ␤-actin, MT-1A, MT-1B, MT-1E, MT-1F, MT-1G, MT-1H, MT-1X, and MT-2A. Reactions were sampled at 25, 30, 35, and 40 cycles, and the products were visualized on 2% agarose gels containing 0.25 µg per ml ethidium bromide.MT Isoform Gene Expression in Three Human Prostate Cancer Cell Lines If the regulation of MT-1 and MT-2 gene expression is altered among individual prostate cancers, it was reasoned that this would be reflected in cell lines derived from prostate cancer. An analysis of MT-1 and MT-2 isoform-specific gene expression patterns proved this hypothesis to be correct. While the pattern of basal expression of the MT isoforms in the Du-145 cell line was similar to that found for the normal prostate, with the MT-1A, MT-1E, MT-1F, MT-1X, and MT2A genes being expressed, this was not true for the PC-3 and LNCaP cell lines (Table I). Specifically, for the PC-3 cell line, no mRNA representing the MT-1A and MT-1E isoform was noted, and in the LNCaP cell line, no expression of the MT-1E isoform was found. In all three prostate cancer cell lines, expression of the MT-1F isoform was clearly detectable, while only 1 of 6 normal prostate samples was noted to express this isoform. Also, the relative level of mRNA for the MT2A isoform was elevated in all three cell lines when compared to the other MT isoforms. Surprisingly, an analysis of MT-1/2 protein expression demonstrated no clear correlation between the pattern of MT-1 and MT-2 isoform mRNA expression and the amount ofMT Gene Expression in Human ProstateTABLE I. Basal MT Expression in Normal Prostate Tissues and Cancer Cell Lines* Tissue 1 2 3 4 5 6 Cell lines DU-145 PC-3 LNCaP G3PDH (30) 11,939 5,620 7,977 6,802 10,294 5,125 (25) 4,379 5,461 4,943 ND ND ND ␤-actin (25) 5,458 2,351 3,372 3,458 5,045 3,931 1A (40) 4,809 4,358 3,657 3,894 4,263 3,788 (40) 7,707 − 6,495 − − − 1B − − − − − − 1E (40) 5,260 9,036 4,987 9,382 9,238 4,659 (35) 9,934 − − 1F (40) 4,862 − − − − − (40) 6,179 5,581 3,054 − − − − − − 1G − − − − − − 1H − − − − − − 1X (35) 9,383 8,329 7,128 8,807 9,464 5,593 (35) 9,294 9,323 9,014 2A (35) 8,810 1,952 8,721 8,406 9,518 16,962 (30) 6,647 8,567 9,665131MT protein 5.30 ± 0.28 2.97 ± 0.19 3.94 ± 0.25 8.71 ± 0.13 6.48 ± 0.01 7.84 ± 0.541.62 ± 0.41 0.92 ± 0.08 0.00a*Sample 1 is depicted in Figure 2. MT protein, ng MT-1⁄2 protein/␮g total protein. ND, not determined. Number of reaction cycles in parentheses. Isoform expression is in units of optical density. a Below detection limit (0.05 ng/␮g protein).total cellular MT-1/2 protein (Table I). While the PC-3 and Du-145 prostate cancer cell lines accumulated similar amounts of MT-1/2 protein, the LNCaP cell line displayed MT-1/2 protein levels that were below the limit of detection (<0.05 ng MT/␮g total protein). MT Isoform Gene Expression in Five Advanced Cases of Human Prostate Cancer The patterns of MT-1 and MT-2 gene expression were also determined on paraffin-embedded tumor samples from 5 patients with advanced-stage prostate cancer. Due to the focal nature of prostate cancer, microdissection of the paraffin-embedded specimens was used to minimize any contamination of the samples with normal tissue. The MT immunoreactivity and area chosen for microdissection were documented for each sample (Fig. 3). In all 5 cases, MT staining intensity was increased compared to normal prostate. In sample 1, MT-1/2 staining was +1 within the cytoplasm of most cells, with occasional cells demonstrating intense (+4) immunoreactivity and nuclear localization. In sample 2, immunoreactivity ranged from +1–+3 and displayed cell to cell variability in both the glandular, cribriform, and micropapillary areas. There were occasional profiles of nuclear localization. In sample 3, immunoreactivity was very strong (+2–+4) and demonstrated some cell to cell variability. There were occasional profiles of nuclear localization. In sample 4, MT-1/2 staining was weak to moderate, with a large degree of cell to cell variability. Only occasional nuclear staining was present. In sample 5, immunoreactivity was intense (+2–+4), with minimal cell to cell variability and only occasional profiles of nuclear localization. The most striking feature of the molecular analysis for MT gene expression was thatnone of the tumor samples expressed mRNA corresponding to the MT-1X gene (Table II). That this was not an artifact of the assay system was confirmed by demonstrating the generation of an MT-1X reaction product in the tumor samples when these samples were “spiked” with total RNA from the normal prostate samples. The expression of MT-2A was demonstrated in all the prostate cancer samples, and the level of expression was similar to that of the ␤-actin housekeeping gene. The expression of MT-1A and MT-1E mRNA was variable among the samples, with 2 samples expressing MT-1A and 3 samples expressing MT-1E. In both instances, expression was far less than that of the ␤-actin housekeeping gene, differing by 10 PCR cycles. All 5 cases were negative for the expression of the MT-1B, 1F, 1G, and 1H isoforms. DISCUSSION The retrospective analysis of MT expression by immunohistochemical methods in a variety of human tumors has demonstrated an association of MT overexpression with the type and grade of tumor. As reviewed by Jasani and Schmid [6], MT overexpression appears to be predominantly associated with the more malignant, higher-grade tumors in ductal breast cancer, skin carcinomas, melanomas, cervical carcinomas, acute lymphoblastic leukemia, and pancreatic carcinomas. In contrast, for colonic, bladder, and fibroblastic skin tumors, MT overexpression is associated with more differentiated lower-grade tumors. The MT antibody (E-9) used in the majority of these studies for immunocytochemical detection of tumor-associated MT overexpression is well-characterized for specificity, and it is known that it is unable to distinguish between the MT-1 and MT-2 isoforms and unable to distinguish between the metal saturated and metal。