Development of improved pUB110 based vectors for pwb980

Journal of Biotechnology72(1999)185–195Development of improved pUB110-based vectors forexpression and secretion studies in Bacillus subtilisSau-Ching Wu,Sui-Lam Wong*Department of Biological Sciences,Di6ision of Cellular,Molecular and Microbial Biology,Uni6ersity of Calgary,2500Uni6ersity Dri6e,N.W.,Calgary,Alberta T2N1N4,CanadaReceived5October1998;received in revised form25February1999;accepted4March1999AbstractpUB110-based vectors are commonly used for expression and secretion studies in Bacillus subtilis.Two of these plasmids,pUB18P43and pWB705,have been applied to produce several proteins of interest.To offer greater flexibility and compatibility in this system,the authors have also constructed a pE194-based plasmid vector(pE18). To determine whether the pUB110-based or the pE194-based vector serves as a better expression system,three structural genes encoding cytoplasmic BirA,extracytoplasmic PrsA and extracellular staphylokinase,respectively, were used as models.Production of these products using pUB110-based vectors was consistently2–3-fold lower than that using the pE194-based vectors.The observed difference in the protein yield did not result from either the rearrangement of the plasmid or the difference in the plasmid copy number.By using three different approaches,the lower production yield from the pUB110-based vectors was found to be due to the transcription interference from the plasmid encoded genes.Thesefindings illustrate that the orientation of the inserted gene in pUB110-based vector can greatly affect gene expression.Two new expression vectors,pUB19P43and pWB980,were constructed to allow better gene expression.©1999Elsevier Science B.V.All rights reserved.Keywords:Expression vectors;pUB110;Bacillus subtilis;BirA;PrsA;Staphylokinase1.IntroductionBacillus subtilis has many attractive features to serve as an expression host for foreign protein production(Behnke,1992;Harwood,1992;Na-garajan,1993;Sarvas,1995;Wong,1995;Bron et al.,1998).These features include the non-patho-genic nature of B.subtilis,well-established safety record,ability to secrete extracellular proteins di-rectly to culture medium,easy genetic manipula-tion,non-biased codon usage and fast growth rate.However,there are at least two major prob-lems associated with the use of B.subtilis as the expression host.These include the presence of high level of extracellular proteases and the for-mation of inclusion bodies for certain proteins (Wang et al.,1989;Pero and Sloma,1993).With the extensive characterization of structural genes*Corresponding author.Tel.:+1-403-2205721;fax:+1-403-2899311.E-mail address:slwong@ucalgary.ca(S.-L.Wong)0168-1656/99/$-see front matter©1999Elsevier Science B.V.All rights reserved. PII:S0168-1656(99)00101-7186S.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195encoding proteases and molecular chaperones,protease deficient strains(Kawamura and Doi,1984;Stahl and Ferrari,1984;Fahnestock andFisher,1987;He et al.,1991;Wu et al.,1991;Yeet al.,1996)and strains(Wu et al.,1998)that canconstitutively coproduce molecular chaperones ata higher level have been constructed.These strainshave been demonstrated to improve both thequality and quantity of the secreted foreignproteins by increasing protein stability(Wu et al.,1993;Wong et al.,1994),minimizing N-terminalheterogeneity(Ye et al.,1999)and promotingprotein solubility(Wu et al.,1998).In combina-tion with appropriate expression vectors,opti-mized culture media and fermentation technology,staphylokinase,a promising blood-clot dissolvingagent(Collen,1998),can be overproduced up to350mg l−1in high quality(Ye et al.,1999).Withthe characterization of key secretory components(Nagarajan,1993;Takamatsu et al.,1997;Tjalsma et al.,1997;Bolhuis et al.,1998;Bron etal.,1998)involved in different secretory pathwaysand the availability of sequence information ofthe entire genome(Kunst et al.,1997),it is possi-ble to engineer B.subtilis to be an idealizedexpression host using rational approaches.Besidesthe expression host,a key component for anexpression system is the expression vector.Manycharacterized endogenous plasmids in bacilli arecryptic.With thefindings that several staphylo-coccal plasmids can be functional in B.subtilis,these plasmids form the basis for the developmentof various cloning and expression vectors for thismicroorganism.Among these plasmids,pUB110(Fig.1A)and pE194are two commonly usedFig. 1.Plasmid maps of pUB110(A),pWB705(B)andpWB980(C).pUB110(Keggins et al.,1978;McKenzie et al.,1986)is the parental plasmid for pUB18and its derivatives.pWB705(Wong et al.,1995)is a pUB18-based secretion vectorcarrying both the constitutive expressed P43promoter and theengineered levansucrase signal sequence.pWB980is a pUB19-based secretion vector.The transcription direction of the P43promoter is the same as that for the majority of the pUB110-encoded genes.rep,kan,ble,mob and sacB SP represent thesequence coding for replicase,kanamycin resistance marker,bleomycin resistance marker,mobilization protein and thelevansucrase signal sequence,respectively.The arrows showthe transcription directions for these genes.S.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195187plasmids in B.subtilis(for reviews see Lovett and Ambulos,1989;Bron,1990;Jannie`re et al.1993). Since they can coexist in the same host,these vectors are key components for a binary expres-sion system in B.subtilis.One of these plasmids can be applied to direct the expression of the inserted DNA fragment encoding the protein of interest while the other plasmid can coproduce accessory factors such as molecular chaperones and transcription activation factors for enhanced production of foreign proteins(Wong et al.1995; Wu et al.,1998).Since the plasmid copy number for pUB110(50–100copies per cell)is much higher than that for pE194(10copies per cell), pUB110and its derivatives have been used exten-sively for expression studies(Behnke,1992;Wang and Doi,1992).To facilitate cloning,a polylinker sequence from pUC18(Norrander et al.,1983) has been introduced to pUB110to generate pUB18(Wong et al.,1988).The authors have then installed a strong,constitutively expressed promoter P43(Wang and Doi,1984)and an engineered levansucrase signal sequence(Wong, 1989)in pUB18to generate a secretion vector pWB705(Fig.1B,Wong et al.1995).Plasmids pUB18and pWB705have been used successfully by us and others to produce various extracellular proteins(Wu et al.,1993;Wong et al.,1994;Lin et al.,1997;Ye et al.,1999)at high levels.To optimize the binary expression vector system,the authors have recently reported the construction of a pE194-based cloning vector pE18(Wu et al., 1998)by replacing part of the sequence from pE194-cop6(Weisblum et al.,1979)with the polylinker sequence from pUC18.pE194-cop6is a mutated pE194with a high plasmid copy number (84copies per cell).In this study,it is interesting to observe that genes inserted in pE18can be expressed at a higher level in comparison with that from pUB18. It is determined that the lower level of gene expression in pUB18is because of interference mediated by promoter activities from the plasmid. This information leads to the construction of two new pUB110-based vectors,pUB19and pWB980 (Fig.1C)that can express genes at a comparable level as that observed from pE18.These vectors also provide a simple means to increase the ex-pression by2–3-fold of genes inserted in pUB18P43and pWB705.2.Materials and methods2.1.Bacterial strains,culture media and culture conditionsBacillus subtilis WB600,a six extracellular protease deficient strain(Wu et al.,1991)was used as the expression host for this study.For protein studies,cells were cultivated in super-rich medium(Halling et al.,1977)containing appro-priate antibiotics at37°C for6–8h.Kanamycin was added at afinal concentration of10m g ml−1 for cells carrying pUB18and its derivatives.Ery-thromycin and lincomycin at afinal concentration of5m g ml−1for each antibiotic were added to cells carrying pE18or its derivatives.Cell growth was monitored by using the Klett–Summerson photoelectric colorimeter with a greenfilter.2.2.Construction of expression6ectors based on pUB18and pE18Two series of plasmids were used in this study. One set was pUB110(McKenzie et al.,1986)and its derivatives and the other was pE18(Wu et al., 1998)and its derivatives.Plasmids pUB18P43(Li and Wong,1992)and pE18P43are derivatives of pUB18and pE18,respectively.They all carry the 300-bp Eco RI-Kpn I fragment with the P43pro-moter in the polylinker region.These vectors were used for intracellular expression.Three structural genes were used as model systems for the expres-sion study.birA(Bower et al.,1995)was amplified using genomic DNA from B.subtilis168as tem-plate with the BIRA primers(Forward primer:5% CCCGGGAAACACATAGAGGAGTGGCTG 3%;Backward primer:5%GGGTCGACGGT-GCAGTTCGCAGGCGATAC3%).The end product was a1-kb birA fragment with a Sma I site at the5%end and a Sal I site at the3%end introduced through the PCR reaction.prsA(Kon-tinen et al.,1991)was amplified as described previously(Wu et al.,1998).Both the birA and prsA fragments were inserted to pUB18P43andS.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195 188pE18P43to generate pUB18P43BIRA,pUB18-P43PRSA,pE18P43BIRA and pE18P43PRSA, respectively.For the study of secretion,the sak gene corresponding to the coding region for the mature staphylokinase was amplified with SAK primers(Forward primer:5%GGGAAGCTTTT-GCCTCGAGCTCATTCGACAAAGG3%Back-ward primer:5%CCCAAGCTTCTGCAG-ATATCGTTTTATTTCTTTTCTATAACAACC 3%)using pDB17(Behnke and Gerlach,1987)as the template.The resulting430-bp fragment has a Hin dIII site at both the5%and3%ends and a Pst I site immediately upstream of the Hin dIII site at the3%end.This fragment was inserted in pWB705 to generate pUB18P43SAK.Secretion of staphy-lokinase was directed by the engineered levansu-crase signal sequence installed in pWB705.To construct pE18P43SAK,the sak expression cas-sette including the P43promoter,levansucrase signal sequence and the mature sak gene was digested from pUB18P43SAK as an880-bp Eco RI-Pst I fragment and was inserted to pE18.2.3.Construction of pUB18P43SAKTThis vector is identical to pUB18P43SAK ex-cept that it carries the T1T2transcription termi-nator complex from the E.coli rrnB operon (Blattner et al.,1997).The rrnB terminator was generated by PCR with RRNB primers(Forward primer:5%GGGCATGCGATATCAGGCAT-CAAATAAAACGAAAG3%and Backward primer:5%GGGTCTAGAGTTAACTAGATAT-GACGACAGGAAG3%)using E.coli genomic DNA as template.It was a270-bp fragment with Sph I and Eco RV sites at the5%end and Hpa I and Xba I sites at the3%end.This fragment was in-serted to pUB18P43SAK to generate pUB18-P43SAKT.2.4.Construction of pUB19,pWB980andpUB19P43SAKTwo PCR primers(PUB19F:5%GGGAAT-TCAGTGCCGACCAAACCATAAAAC3%and PUB19B:5%GGGAAGCTTCAGCACAATTC-CAAGAAAAACAC3%)were designed for PCR with pUB110as the template to generate a3285 bp fragment.A Sma I half site and an Eco RI site were introduced at the5%end of the forward primer followed by the sequence corresponding to nucleotides1204–1226in pUB110(sequence is numbered according to the Genbankfile M19465).For the backward primer,a Sma I half site and a Hin dIII site were introduced at the5% end followed by the sequence corresponding to nucleotides4472–4450in pUB110.The amplified DNA fragment was self-ligated to form a circular DNA with a Sma I site regenerated.The ligated DNA was transformed to WB600and the result-ing plasmid was designated pUB19HR.This plas-mid was digested with Hin dIII and Eco RI and ligated with the polylinker sequence(a Hin dIII-Eco RI fragment)from pUC18to generate pUB19.To develop the secretion vector pWB980, a450-bp Eco RI-Pst I fragment carrying the P43 promoter and the engineered levansucrase signal sequence from pWB705was inserted to pUB19to generate pWB980(Fig.1C).To construct pUB19P43SAK,the430-bp Hin dIII-Pst I frag-ment carrying the structural gene encoding the mature Sak was inserted to pWB980.2.5.Cell fractionationAt the end of the culture period,cells were harvested by centrifugation to give the culture supernatant(secreted fraction)and the cell pellet. The cell pellet was washed once with PBS,resus-pended in cell disruption buffer(30mM Tris–HCl,100mM NaCl,5mM EDTA,1mM phenylmethylsulfonylfluoride,pH7.4)and lysed by French press.The soluble fraction was sepa-rated from the insoluble fraction(comprising the membrane fraction and inclusion bodies)by cen-trifugation at20000×g for20min.2.6.Other methodsAll PCR reactions were performed using Vent polymerase(New England Biolabs).The se-quences of the subcloned PCR products were confirmed to be free of PCR errors by nucleotide sequencing.The PCR conditions,nucleotide se-quencing,B.subtilis plasmid transformation,S.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195189protein electrophoresis and Western blotting were done as described previously(Wu et al.,1998;Ye et al.,1999).To quantify the band intensity of BirA,PrsA and Sak,images of the protein gel were taken using the GDS7500gel documenta-tion system from UVP.The digitized images were then analysed using the Fuji bio-imaging analyzer system(BAS1000,Fuji Photo Film)with the MacBAS software.Plasmid copy number determi-nation was performed using the agarose gel elec-trophoresis method(Method3.18)described by Sierd Bron(Bron,1990).3.Results3.1.Plasmid pE18P43is a better expression6ector than pUB18P43To determine whether pE18P43or pUB18P43serves as a better expression vector,three genes encoding gene products(BirA,PrsA and staphy-lokinase)at different cellular locations were in-serted into these vectors for expression studies.B. subtilis BirA is an intracellular cytoplasmic protein with dual functions(Bower et al.,1995).It serves as a biotin ligase to mediate protein bi-otinylation and as a repressor which regulates the expression of genes encoding biotin biosynthetic enzymes.B.subtilis PrsA is a33-kDa membrane-bound lipoprotein that functions as an extracyto-plasmic molecular chaperone(Jacobs et al.,1993). Staphylokinase(Sak)is a16-kDa extracellular protein from certain strains of Staphyloccocus au-reus and is a promising blood clot dissolving agent(Behnke and Gerlach,1987;Collen,1998). All these genes are expressed under control of a strong and constitutively expressed B.subtilis P43 promoter.As shown in Fig.2,WB600cells carry-ing pE18P43derivatives consistently producedparison of the BirA,PrsA and Sak production from pE18and pUB18.The amounts of protein loaded to the gel were normalized against the cell density from each culture.(A)Protein profiles of cellular fractions from the BirA and PrsA production ne1:molecular weight nes2–5:soluble cellular cytoplasmic fractions from WB600[pUB18P43](negative control);WB600[pUB18P43BIRA];WB600[pE18P43BIRA]and WB600[pE18P43](negative control),nes6–8: insoluble cellular fractions(including the membrane fraction)from WB600[pUB18P43PRSA];WB600[pE18P43PRSA]and WB600[pE18P43](negative control),respectively.The positions of BirA(36kDa with an apparent molecular mass of40kDa)and PrsA(33kDa)are indicated by a closed circle and an arrow,respectively.All the samples in this panel were analyzed on a10% SDS-polyacrylamide gel.(B)Protein profile of the secreted fraction from the Sak production strains analyzed on a12% SDS-polylacrylamide ne1:molecular weight nes2–4:secreted fractions from WB600[pUB18P43SAK]; WB600[pE18P43SAK]and WB600[pUB18P43](negative control),respectively.S.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195190Fig.3.Staphylokinase production from WB600carrying pUB18and pUB19series.Culture supernatant from each sample was analyzed on a12%SDS-polyacrylamide nes1–8:molecular weight markers,WB600[pUB18P43SAK]; WB600[pUB18P43SAKT];WB600[pUB18P43SAKR];WB600[pUB18P43SAKTR];WB600[pUB19P43SAK];WB600[pUB18SAK] and WB600[pUB18P43](negative control).The amounts of protein loaded to the gel were normalized against the cell density from each culture.more BirA,PrsA and staphylokinase than those carrying the pUB18P43derivatives.From two independent experiments,BirA,PrsA and staphy-lokinase from the pE18P43system are3,2.6and 2.9-fold higher than those from the pUB18P43 system,respectively.3.2.Transcription interference from pUB18P43At least two possible factors can account for the observed lower level of protein production from the pUB18P43plasmid system.Thefirst one is transcription interference.pUB110carries four structural genes encoding RepB for plasmid repli-cation,Kan and Ble for kanamycin and bleomycin resistance,respectively,and Pre(Mob) for site-specific recombination and conjugative transfer of the plasmid(Bron,1990;Selinger et al.,1990).All these genes are transcribed in the same direction(Fig.1A).During the construction of pUB18P43,a major portion(Eco RI to P6u II) of sequence encoding mob from pUB110was deleted and replaced by the polylinker sequence from pUC18.Since the polylinker sequence and the P43promoter are installed within mob and the transcription direction of P43is opposite to that from the plasmid encoded genes,the promoter activity(Williams et al.,1981;Zyprian and Matzura,1986)from mob or the read-through transcription from the upstream ble gene can gen-erate antisense transcripts that may interfere with the expression of genes inserted downstream from the P43promoter.To test this hypothesis,three approaches were used.First,we examine whether there is promoter activity originating from the plasmid that can read through the polylinker re-gion in an anticlockwise direction(Fig.1B).A promoterless staphylokinase gene was inserted in the polylinker region with its transcription direc-tion the same as that from mob.WB600carrying this plasmid(pUB18SAK)not only could produce staphylokinase,its production level was even slightly higher(1.6-fold)than that from WB600[pUB18P43SAK](Fig.3,ne2). If the promoter activity from the plasmid encoded genes would indeed interfere with the expressionS.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195191of sak from the P43promoter,installation of a bidirectional transcription terminator at the3%end of sak should reduce the transcriptional interfer-ence.The E.coli T1T2terminator complex from the rrnB operon has been shown to be functional in both directions in B.subtilis(Peschke et al., 1985;Wang and Doi,1987).Installation of this terminator complex at the3%end of sak in pUB18P43SAK generated two new plasmids. pUB18P43SAKT has the terminator complex inserted in the T1T2orientation while pUB18P43SAKTO has the terminator complex inserted in the opposite orientation(i.e.T2T1). Strains carrying these two plasmids showed a comparable production yield of staphylokinase (data not shown).However,WB600carrying one of these plasmids indeed produced staphylokin-ase 3.7-fold higher than that from WB600[pUB18P43SAK](Fig.3,ne2). The third approach is to insert the P43-SAK expression cassette in pUB18with its transcrip-tion direction to be the same from the plas-mid.Two versions of plasmid were generated. One(pUB18P43SAKR)did not have the rrnB terminator inserted while the other (pUB18P43SAKTR)carried the rrnB terminator.WB600cells carrying these two plasmids produce Sak at a comparable level which is at least5-fold higher than that from WB600[pUB18P43SAK] (Fig.3,ne2).The reason for the Sak production level from these two strains to be even higher than that from WB600[pUB18P43SAKT]is likely resulting from the additional transcription activity(Williams et al.,1981;Zyprian and Matzura,1986)from mob or other plasmid encoded genes.parison of staphylokinase production using different6ector systemsSince WB600[pUB18P43SAKR]produced staphylokinase in high yield,it would be interest-ing to compare the production level from this system with that from WB600[pE18P43SAK].As shown in Fig.4,both systems produce secreted staphylokinase in the culture supernatant and staphylokinase precursor in the soluble cellular fraction at a similar level.Small amounts of ma-ture Sak were found in the soluble cellular frac-tions from both systems as confirmed by Western blotting with Sak specific antiserum.For insoluble cellular fractions,WB600[pE18P43SAK]accumu-lated a higher level of staphylokinase precursor.parison of Sak production from WB600[pUB18P43SAKR]and WB600[pE18P43SAK]in various cell fractions.The amounts of protein loaded to the gel were normalized against the cell density from each culture. A.Coomassie-stained SDS-polyacrylamide ne1:molecular weight markers,Lanes2–4,5–7and8–10:culture supernatant;soluble cellular fractions and insoluble cellular fractions from WB600[pE18P43SAK],WB600[pUB18P43SAKR]and WB600[pWB705](negative control),respectively.B.Western blot probed with mouse antiserum raised specially against Sak(Ye et al.,1999).Lane1:prestained nes2–10are as described in panel A.The position of Sak precursor and mature Sak are marked by closed and open arrowheads.S.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195 192Table1Plasmid copy number in WB600aPlasmid Copy number pUB18122(115,128)118(113,122) pUB18P43SAK128(125,131) pUB18P43SAKR121(119,123) pUB19P43SAK83(81,85)pE18pE18P43SAK81(79,83)a The values represent an average of two independent deter-minations of plasmid copy number in WB600.The actual value for each determination is shown in bracket.construction of a new plasmid designated pUB19 which is399bp shorter than pUB18.Insertion of a300-bp Eco RI-Kpn I fragment carrying the P43 promoter and a450-bp Eco RI-Pst I fragment car-rying both the P43promoter and the engineered levansucrase signal sequence to pUB19generate pUB19P43and pWB980,respectively.Genes pre-viously inserted in pUB18P43and pWB705for expression studies can easily be transferred to pUB19P43and pWB980for a higher level of expression.To test the functionality of pWB980,a Hin dIII-Pst I fragment encoding mature staphy-lokinase was inserted to pWB980to generate pUB19P43SAK which has a copy number com-parable to pUB18(Table1).WB600carrying this plasmid produced Sak in the culture medium at a level which was similar to that from WB600[pUB18P43SAKR](Fig.3,ne 4).Relative to pWB705,pWB980not only allows better expression of inserted genes,it carries a unique Hin dIII site that could be used in combi-nation with other unique restriction sites to have the subcloned DNA fragments inserted in an ori-entation specific manner for expression purpose.4.DiscussionPlasmid pUB110and its derivatives have been used widely in B.subtilis as cloning and expres-sion vectors,secretion vectors and promoter-probe vectors(for reviews,see Behnke,1992; Wang and Doi,1992).It is interesting to observe that genes encoding B.subtilis or foreign proteins inserted in pUB18P43are consistently being ex-pressed in B.subtilis at a lower level than in pE18P43.This observation is true for intracellular protein(BirA),extracytoplasmic membrane protein(PrsA),and secretory protein(Sak)inde-pendent of theirfinal cellular locations.The lower expression level can be because of plasmid rear-ragnement,lower copy number or interference from promoter activity originated from pUB18. pUB18P43derivatives carrying different inserts (e.g.genes encoding BirA,PrsA and Sak with the levansucrase signal sequence)had been isolated from B.subtilis cultivated for2–24h and restric-tion characterization showed no indication for3.4.Copy number difference in pUB18and pE18 is not a major factor determining the production yield of proteins of interestThe second possible factor that accounts for higher protein production from the pE18series is the difference in plasmid copy number for pE18 and pUB18.As shown in Table1,the plasmid copy number of pUB18is even higher than that of pE18.Insertion of DNA fragments to these vectors did not cause any significant change in plasmid copy number.Furthermore, pUB18P43SAK and pUB18P43SAKR showed a big difference in staphylokinase production even though they have similar copy numbers per cell. All these data demonstrate that the difference in the plasmid copy number in these vector systems is not a major factor to account for the observed difference in protein production.3.5.De6elopment of an impro6ed secretion6ector pWB980With the convenience of PCR,many genes inserted in pUB18P43could be generated through PCR with one or more unique restriction enzyme sites introduced at each end of these fragments. These PCR products could then be inserted to pUB18P43in an orientation specific manner by forced cloning using two different restriction en-zyme sites.The currentfindings suggest that a simple way to improve the expression of these genes is toflip the polylinker sequence in pUB18 in an opposite orientation.This resulted in theS.-C.Wu,S.-L.Wong/Journal of Biotechnology72(1999)185–195193plasmid rearrangement(data not shown).Plasmid copy number determination(Table1)demon-strated that the copy number of the pUB18series is even higher than that of the pE18series.This finding eliminated the possibility of the copy num-ber difference for these two series of plasmids to be accountable for the observed difference in gene expression.Studies using three different ap-proaches demonstrated that promoter activity from the plasmid encoded genes in pUB18P43 clearly interfered with expression of the P43ex-pression cassette.Formation of antisense RNA can potentially result in faster turnover of tran-scripts directed by the P43promoter and interfere with translation particularly at the initiation pro-cess(Wagner and Simons,1994;Delihas,1995). The significance of thisfinding is4-fold.(1)Be-sides the pUB18P43and pWB705systems,the transcription direction of the inserted genes in many other pUB110-based expression systems is also opposite to that from mob and other plasmid encoded genes.A few examples of these systems include the production of protein A in pGX2928/ pGX2929(Fahnestock and Fisher,1986),human atrial natriuretic a-factor in pSJ15(Wang et al., 1988),Bacillus bre6is47cell wall protein in pTT5 (Tsukagoshi et al.,1984),b-lactamse in pSM119 (Grandi et al.,1986),and cyclodextrin glucan-otransferase in pDS12/20(Takano et al.,1986). The expression of these inserted genes can poten-tially be enhanced byflipping the inserted genes to the opposite orientation.(2)An improved secre-tion vector pWB980was developed to allow ex-pression of genes of interest at a higher level. These genes can be inserted easily in an orienta-tion specific manner.(3)In developing pUB110-based promoter-probe plasmids(Duvall et al., 1984;Wang and Doi,1987)in Bacillus subtilis, promoterless reporter genes have been inserted with their transcription direction opposite to that from the plasmid encoded genes.Without the installation of bidirectional transcription termina-tor at the3%end of these reporter genes,the observed promoter activity of the inserted pro-moters in these vectors may not reflect the full strength of the promoter.(4)Plasmid pUB19P43 allows the production of proteins of interest at a level that is comparable to that from pE18P43.Since these two plasmids can coexist in the same cell,this plasmid pair can potentially be applied to produce heterodimeric proteins with maximum yield.Otherwise,any subunit in excess will not be able to form functional heterodimers because of the lack of the other subunit. AcknowledgementsThe authors would like to thank Dr Detlev Behne for the supply of pDB17.This work was supported by a strategic grant from Natural Sci-ences and Engineering Research Council of Canada.S.-L.Wong is a senior medical scholar from Alberta Heritage Foundation for Medical Research.ReferencesBehnke, D.,1992.Protein export and the development of secretion vectors.In:Doi,R.H.,McGloughlin,M.(Eds.), Biology of Bacilli:Applications to industry.MA:Butter-worth-Heinemann,pp.143–188.Behnke, D.,Gerlach, D.,1987.Cloning and expression in Escherichia coli,Bacillus subtilis,and Streptococcus sanguis of a gene for staphylokinase-a bacterial plasminogen acti-vator.Mol.Gen.Genet.210,528–534.Blattner,F.R.,Plunkett,G.,et al.,1997.The complete genome sequence of Escherichia coli K–12.Science277,1453–1474.Bolhuis,A.,Broekhuizen,C.P.,Sorokin,A.,van Roosmalen, M.L.,Venema,G.,Bron,S.,Quax,W.J.,Van Dijl,J.M., 1998.SecDF of Bacillus subtilis,a molecular Siamese twin required for the efficient secretion of proteins.J.Biol.Chem.273,21217–21224.Bower,S.,Perkins,J.,Yocum,R.R.,et al.,1995.Cloning and characterization of the Bacillus subtilis birA gene encodinga repressor of the biotin operon.J.Bacteriol.177,2572–2575.Bron,S.,1990.Plasmids.In:Harwood,C.R.,Cutting,S.M.(Eds.),Molecular Biological Methods for Bacillus.Wiley, Chichester,pp.75–174.Bron,S.,Bolhuis,A.,Tjalsma,H.,Holsappel,S.,Venema,G., Van Dijl,J.M.,1998.Protein secretion and possible roles for multiple signal peptidases for precursor processing in bacilli.J.Biotechnol.64,3–13.Collen,D.,1998.Staphylokinase:a potent,uniquelyfibrin-se-lective thrombolytic agent.Nat.Med.4,279–284. Delihas,N.,1995.Regulation of gene expression by trans-en-coded antisense RNAs.Mol.Microbiol.15,411–414.。