真菌检测鉴定通用引物-Fungal Primers

ITS1: 5’-CCGTAGGTGAACCTGCGG-3’ITS4:5’-TCCTCCGCTTATTGATATGC-3’ Tm 55℃NS17: CATGTCTAAGTTTAAGCAANS3: GCAAGTCTGGTGCCAGCAGCCNS4: CTTCCGTCAATTCCTTTAAGNS22: AATTAAGCAGACAAATCACTNS24: AAACCTTgTTACgACTTTTALR0R: 5’-GTACCCGCTGAACTTAAGC-3’LR3: 5’-CCGTGTTTCAAGACGGGLR3R: 5’-GTCTTGAAACACGGACC (complementary to RLR3R: GGTCCGTGTTTCAAGAC)LR5: 5’-TTAAAAAGCTCGTAGTTGAAC-3’LR7: 5’-TACTACCACCAAGATCTLR12: 5’-GACTTAGAGGCGTTCAGLr0R/LR5: Tm 50-52℃NL1: 5’-GCATATCAATAAGCGGAGGAAAAGNL1: 5′-TGCGTTGATTACGTCCCTGC (also called V9: TGCGTTGATTACGTCCCTGC) NL1: 5’-TGCTGGAGCCATGGATC-3NL2: 5’-CTCTCTTTTCAAAGTTCTTTTCATCTNL2: 5’-AACGGCTTCGACAACAGC-3NL2: 5’-CTTGTTCGCTATCGGTCTC (also NL2A: 5′-CTTGTTCGCTATCGGTCTC)NL2: 5’-TACTTGTTCGCTATCGGTCT-3'NL3: 5’-GAGACCGATAGCGAACAAG (also NL3A: 5’-GAGACCGATAGCGAACAAG)NL3: 5’-AGACCGATAGCGAACAAGTANL3: 5’NL4: 5’-GGTCCGTGTTTCAAGACGG （similar to RLR3R：5′-GGTCCGTGTTTCAAGAC) NL4: 5’-TAGATACATGGCGCAGTC-3Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA (/fungi/mycolab/primers.htm)Vilgalys lab, Duke UniversityOver the years, our lab has compiled a useful list of conserved primer sequences useful for amplification and sequencing of nuclear rDNA from most major groups of fungi (primarily Eumycota), as well as other eukaryotes. All of these primers were identified and tested by our own lab based on consensus between the published large and small subunit RNA sequences from fungi, plants and other eukaryotes; sources of other useful primer sequences from published literature are also indicated. Together, these primers span most of the nuclear rDNA coding region (see figures), permitting amplification of any desired region. Standard symbols are used for the four primary nucleotides; variable positions are indicated as follows: P=A,G / Q=C,T / R=A,T /V=A,C / W=G,T. Primers ending with "R" represent the coding strand (same as RNA). All other primers are complementary to the coding strand. This information is provided freely and may be passed on to anyone who wants to use it.The nuclear-encoded ribosomal RNA genes (rDNA) of fungi exist as a multiple-copy gene family comprised of highly similar DNA sequences (typically from 8-12 kb each) arranged in ahead-to-toe manner. Each repeat unit has coding regions for one major transcript (containing the primary rRNAs for a single ribosome), punctuated by one or more intergenic spacer (IGS) regions. In some groups (mostly basidiomcyetes and some ascomycetous yeasts), each repeat also has a separately transcribed coding region for 5S RNA whose position and direction of transcription may vay among groups. Several restriction sites for EcoRI and BglII are conserved in the rDNA of fungi. Nearly all basidiomycetes we've studied share an EcoRI site within the 5.8S RNA gene along with a BglII site halfway into the LSU RNA sequence. Primers 5.8SR and LR7 include these restriction sites, which makes them convenient for cloning.For those who aren't familiar with rDNA and fungal systematics, several excellent reviews are available on fungi (Hibbett, 1992) and generally for eukaryotes (Hillis and Dixon, 1991). See Gerbi (1986) for a general introduction to the molecular biology and evolution of rDNA in other eukaryotes. Another useful source of primer information may be found in Gargas & Depriest (1996) and at the Tom Bruns lab web site /boletus/boletus.html.Small subunit RNA (SR) primers:Primer name Sequence (5'-->3')Position within S. cereviseae 17S RNA BMB-'A' GRATTACCGCGGCWGCTG 580-558BMB-'B' CCGTCAATTCVTTTPAGTTT 1146-1127BMB-'C' ACGGGCGGTGTGTPC 1638-1624BMB-BR CTTAAAGGAATTGACGGAA 1130-1148BMB-CR GTACACACCGCCCGTCG 1624-1640SR1R TACCTGGTTGATQCTGCCAGT 1-21SR1 ATTACCGCGGCTGCT 578-564SR2 CGGCCATGCACCACC 1277-1263SR3 GAAAGTTGATAGGGCT 318-302SR4 AAACCAACAAAATAGAA 838-820SR5 GTGCCCTTCCGTCAATT 1146-1130SR6 TGTTACGACTTTTACTT 1760-1744SR6R AAGWAAAAGTCGTAACAAGG 1744-1763SR7 GTTCAACTACGAGCTTTTTAA 617-637SR7R AGTTAAAAAGCTCGTAGTTG 637-617SR8R GAACCAGGACTTTTACCTT 732-749SR9R QAGAGGTGAAATTCT 896-910SR10R TTTGACTCAACACGGG 1181-1196NS1 GTAGTCATATGCTTGTCTCNS2 GGCTGCTGGCACCAGACTTGCNS3 GCAAGTCTGGTGCCAGCAGCCNS4 CTTCCGTCAATTCCTTTAAG (similar to BMB-B)NS5 AACTTAAAGGAATTGACGGAAG (is similar to BMB-BR)NS6 GCATCACAGACCTGTTATTGCCTCNS7 GAGGCAATAACAGGTCTGTGATGCNS8 TCCGCAGGTTCACCTACGGASR = primers developed by Vilgalys labNS = primers described by White et al., 1990Large subunit RNA (25-28S) primer sequencesNote: most molecular systematics studies only utilizethe first 600-900 bases from the LSU gene, which includes three divergent domains (D1, D2, D3) that are among the most variable regions within the entire gene (much of the LSU is invariant even across widely divergent taxa). Most ofthe data in our Agaricales LSU database consists of the first 900 bases from the LSU gene (we typically amplify using primers 5.8SR + LR7, followed by sequencing using primers LR5, LR16,LR0R, and LR3R).Primer name Sequence (5'-->3')Position within S. cereviseae rRNA comments5.8S CGCTGCGTTCTTCATCG 51-35 (5.8S RNA) contains EcoRI site 5.8SR TCGATGAAGAACGCAGCG 34-51 (5.8S RNA) contains EcoRI site LR0R ACCCGCTGAACTTAAGC 26-42LR1 GGTTGGTTTCTTTTCCT 73-57LR2 TTTTCAAAGTTCTTTTC 385-370LR2R AAGAACTTTGAAAAGAG 374-389LR3 CCGTGTTTCAAGACGGG 651-635LR3R GTCTTGAAACACGGACC 638-654LR4 ACCAGAGTTTCCTCTGG 854-838LR5 TCCTGAGGGAAACTTCG 964-948LR6 CGCCAGTTCTGCTTACC 1141-1125LR7 TACTACCACCAAGATCT 1448-1432 contains BglII site LR7R GCAGATCTTGGTGGTAG 1430-1446 contains BglII site LR8 CACCTTGGAGACCTGCT 1861-1845LR8R AGCAGGTCTCCAAGGTG 1845-1861LR9 AGAGCACTGGGCAGAAA 2204-2188LR10 AGTCAAGCTCAACAGGG 2420-2404LR10R GACCCTGTTGAGCTTGA 2402-2418LR11 GCCAGTTATCCCTGTGGTAA 2821-2802LR12 GACTTAGAGGCGTTCAG 3124-3106LR12R CTGAACGCCTCTAAGTCAGAA 3106-3126LR13 CGTAACAACAAGGCTACT 3357-3340LR14 AGCCAAACTCCCCACCTG 2616-2599LR15 TAAATTACAACTCGGAC 154-138LR16 TTCCACCCAAACACTCG 1081-1065LR17R TAACCTATTCTCAAACTT 1033-1050LR20R GTGAGACAGGTTAGTTTTACCCT 2959-2982LR21 ACTTCAAGCGTTTCCCTTT 424-393LR22 CCTCACGGTACTTGTTCGCT 364-344Internal transcribed spacer (ITS) region primersThe ITS region is now perhaps the most widely sequenced DNA region in fungi. It has typically been most useful for molecular systematics at the species level, and even within species (e.g., to identify geographic races). Because of its higher degree of variation than other genic regions of rDNA (SSU and LSU), variation among individual rDNA repeats can sometimes be observed within both the ITS and IGS regions. In addition to the standard ITS1+ITS4 primers used by most labs, everal taxon-specific primers have been described that allow selective amplification of fungal sequences (e.g., see Gardes & Bruns 1993 paper describing amplification of basidiomycete ITS sequences from mycorrhiza samples).primer name sequence (5'->3')comments referenceITS1 TCCGTAGGTGAACCTGCGG White et al, 1990ITS2 GCTGCGTTCTTCATCGATGC (is similar to 5.8S below) White et al, 1990ITS3 GCATCGATGAAGAACGCAGC (is similar to 5.8SR below) White et al, 1990ITS4 TCCTCCGCTTATTGATATGC White et al, 1990ITS5 GGAAGTAAAAGTCGTAACAAGG (is similar to SR6R) White et al, 1990ITS1-F CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns, 1993 ITS4-B CAGGAGACTTGTACACGGTCCAG Gardes & Bruns, 1993 5.8S CGCTGCGTTCTTCATCG Vilgalys lab5.8SR TCGATGAAGAACGCAGCG Vilgalys labSR6R AAGWAAAAGTCGTAACAAGG Vilgalys labIntergenic spacer (IGS) primers (including 5S RNA primer sequences for basidiomycete fungi)The greatest amount sequence variation in rDNA exists within the IGS region (sometimes also known as the non-transcribed spacer or NTS region). The size of the IGS region may vary from 2 kb upwards. It is not unusual to find hypervariability for this region (necessitating cloning ofindividual repeat haplotypes). Several patterns of organization can be found in different groups of fungi:1. Most filamentous ascomycetes have a single uninterrupted IGS region (between the endof the LSU and start of the next SSU sequence), which may vary in length from 2-5 kb or more. Amplification of the entire IGS region requires using primers anchored in the 3' end of the LSU gene (e.g., LR12R) and 5' end of the SSU RNA gene (e.g., invSR1R).2. In many ascomycetous yeasts and nearly all basidiomycetes, the IGS also contains asingle coding region for the 5S RNA gene, which divides the IGS into two smaller regions that may be more easily amplified using. Depending on the orientation and position of the 5S RNA gene, the PCR may be used to sequentially amplify either aportion of theintergenic spacer region (IGS) beyond the large subunit RNA coding region.REFERENCESBruns, T. D., R. Vilgalys, S. M. Barns, D. Gonzalez, D. S. Hibbett, D. J. Lane, L. Simon, S. Stickel, T. M. Szaro, W. G. Weisburg, and M. L. Sogin. 1992. Evolutionary relationships within the fungi: analyses of nuclear small subunit rRNA sequences. Molec. Phylog. Evol. 1: 231-241.Bruns, T. D., T. J. White, and J. W. Taylor. 1991. Fungal molecular systematics. Ann. Rev. Ecol. Syst. 22: 525-564.DePriest, P. T., and M. D. Been. 1992. Numerous group I introns with variable distributions in the ribosomal DNA of a lichen fungus. J. Mol. Biol. 228: 315-321.Elwood, H. J., G. J. Olsen, and M. L. Sogin. 1985. The small subunit ribosomal RNA gene sequences from the hypotrichous ciliates Oxytricha nova and Stylonychia pustula. Mol. Biol. Evol. 2: 399-410.Gardes, M., and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.Gargas, A., and P.T. DePriest. 1996. A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA.Mycologia 88: 745-748Gargas, A., and J.W. Taylor. 1992. Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA fromlichenized fungi. Mycologia 84: 589-592.Gerbi, S. A. 1986. Chapter 7 - Evolution of ribosomal DNA. Pp. 419-517 In: Molecular evolution, ed. McIntyre, R.Hibbett, D. S. 1991. Phylogenetic relationships of the Basidiomycete genus Lentinus: evidence from ribosomal RNA and morphology. Ph.D. Thesis, Duke University, 1991.Hibbett, D. S. 1992. Ribosomal RNA and fungal systematics. Trans. Mycol. Soc. Jpn. 33: 533-556.Hibbett, D. S., and R. Vilgalys. 1991. Evolutionary relationships of Lentinus to the Polyporaceae: evidence from restriction analysis of enzymatically amplified ribosomal DNA. Mycologia 83:425-439.Hibbett, D. S., and R. Vilgalys. 1993. Phylogenetic relationships of the Basidiomycete genus Lentinus inferred from molecular and morphological characters. Syst. Bot. 18: 409-433.Hillis, D. M., and M. T. Dixon. 1991. Ribosomal DNA: molecular evoluiton and phylogenetic inference. Quart. Rev. Biol. 66: 411-453.Hopple, J. S., Jr., and R. Vilgalys. 1994. Phylogenetic relationship among coprinoid taxa and allies based on data from restriction site mapping of nuclear rDNA. Mycologia 86: 96-107.Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and N. R. Pace. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci., U. S. A. 82: 6955-6959.Vilgalys, R., and D. Gonzalez. 1990. Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet. 18: 277-280.Vilgalys, R., J. S. Hopple, Jr., and D. S. Hibbett. 1994. Phylogenetic implications of generic concepts in fungal taxonomy: The impact of molecular systematic studies. Mycologica Helvetica 6: 73-91.White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York. ©W°。