,DanaIAssociation of MicroRNA-223 Expression with Hepatic

ORIGINAL ARTICLEAssociation of MicroRNA-223Expression with Hepatic Ischemia/Reperfusion Injury in MiceChao-Hui Yu ÆCheng-Fu Xu ÆYou-Ming LiReceived:20August 2008/Accepted:12November 2008ÓSpringer Science+Business Media,LLC 2008Abstract MicroRNAs are a group of small non-coding RNAs with modulator activity of gene expression.Recent studies have uncovered a profound role of microRNAs in liver diseases.This study aimed to investigate a potential relationship between microRNA-223(miR-223)expression and hepatic ischemia/reperfusion injury in mice.Quanti-tative RT-PCR analysis showed that miR-223expression levels were greatly up-regulated in the livers after 75min ischemia followed by 120min reperfusion when compared to sham controls (2.59±0.23vs.0.83±0.15;P \0.01).Correlation analysis also revealed that hepatic miR-223expression level was significantly positively correlated with serum markers of ischemic injury.By prediction assay of miRNA targets mRNA,acyl-CoA synthetase long-chain family member 3,ephrin A1,and ras homolog gene family member B were predicted to be downstream targets of miR-223.Thus,we conclude that hepatic ischemia/reper-fusion injury might be another form of liver disease that is associated with alteration in miR-223expression.Keywords Ischemia ÁReperfusion injury ÁMicroRNA-223ÁMouse IntroductionHepatic ischemia/reperfusion (I/R)injury is a common problem which occurs in major liver resection and livertransplantation,which subsequently causes significant parenchymal hepatocyte injury and organ dysfunction [1–4].With respect to liver transplantation,I/R injury is responsible for up to one-tenth of early organ failure and may increase the incidence of both acute and chronic rejection [5].Due to organ shortage,marginal organs such as steatotic grafts are used in liver transplantation [6].The use of marginal organs significantly increases the severity of I/R injury and thereby increases the risk of initial poor function and primary non-function after transplantation [6–8].Therefore,fully understanding the mechanism of hepatic I/R injury and developing effective approaches to reduce the injury would have significant clinical importance.Hepatic I/R injury triggers a multifaceted cascade of physiological and biochemical events [9].It is believed that these events are partially medicated by alteration in molec-ular processes such as transcription and translation [10–12].MicroRNAs (miRNAs)are a class of endogenously expres-sed small non-coding RNAs that are involved in regulation of translation and degradation of messenger RNA (mRNA)[13].Recent studies have uncovered a profound and unex-pected regulatory role of miRNAs in various liver diseases including hepatocellular carcinoma [14,15],hepatitis C [16],and toxin-induced liver injury [17].Specific manipulation of a single miRNA has been correlated with particular pathophysiological processes in liver diseases [18].MicroRNA-223(miR-223)is one of the miRNAs that has been given much attention in the literature.This miRNA is usually regarded as a bone marrow specific miRNA that functions as an important modulator of cel-lular differentiation [19,20].In addition to this,a recent study observed that miR-223was commonly repressed in hepatocellular carcinoma [21],suggesting a potential role of this miRNA in liver disease.To date,however,the role of miR-223in hepatic I/R injury has not been reported.Chao-Hui Yu and Cheng-Fu Xu contributed equally to this work.C.-H.Yu ÁC.-F.Xu ÁY.-M.Li (&)Department of Gastroenterology,The First Affiliated Hospital,College of Medicine,Zhejiang University,79Qingchun Road,Hangzhou 310003,China e-mail:xiaofu@ Dig Dis SciDOI 10.1007/s10620-008-0629-8In this study,we analyzed the expression change of miR-223in mouse livers subjected to I/R injury by quantitative reverse transcription-polymerase chain reac-tion(RT-PCR),and a potential regulatory mechanism of miR-223in hepatic I/R injury was studied by further analyses.Materials and MethodsAnimalsMale C57BL/6mice weighing23–26g were purchased from Shanghai SLAC Laboratory Animals(Shanghai, China).All mice were maintained in a standard facility and allowed access to food and water ad libitum.After accli-matizing to laboratory conditions for2weeks,the mice were randomly divided into two groups of six mice each: (i)the sham group underwent a sham operation without vascular occultation;and(ii)the I/R group underwent 75min of hepatic ischemia and120min of reperfusion.All experiments were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.Hepatic IschemiaA non-lethal model of partial(70%)hepatic ischemia was used,as described in our previous study[22].Surgery was performed under anesthesia obtained with an intraperito-neal injection of50–60mg sodium pentobarbital per kilogram.During anesthesia,body temperature was moni-tored with a rectal probe and maintained between36.5and 37.5°C by a heating pad.After a midline laparotomy,all structures in the portal trial to the left and median liver were occluded for75min using an atraumatic vascular clamp;reperfusion was initiated by removing the clamp. The abdominal incision was then closed in two layers with 4–0silk sutures,and0.4ml of physiological saline was injected subcutaneously to compensate for the operative fluid loss.During reperfusion,the mice were kept in clean cages with no further administration of anesthetic.After 120min of reperfusion,blood and liver samples were obtained for further analysis.All surgeries were performed by the same individual(X.CÁF.).Serum Enzyme AnalysesSerum aspartate aminotransferase(AST)and alanine ami-notransferase(ALT)levels were measured as markers of hepatocyte injury using an Autolab Analyzer(Rome,Italy) and expressed in international units/liter(IU/l).Histological Examination of LiverTissue samples from the left lateral hepatic lobe werefixed in10%neutral-buffered formalin,embedded in paraffin, sectioned at4l m thickness,and stained with hematoxylin and eosin.Light microscopy was used to evaluate the degree of liver damage,which was performed by two pathologists who were unaware of the treatment.Grading of hepatic injury was determined as described previously [22]:grade0,minimal or no evidence of injury;grade1, mild injury consisting of cytoplasm vacuolation and focal nuclear pyknosis;grade2,moderate to severe injury with extensive nuclear pyknosis,cytoplasmic hypereosinophilia, and loss of intercellular borders;and grade3,severe necrosis with disintegration of hepatic coeds,hemorrhage, and neutrophil infiltration.Quantitative Real-Time RT-PCRTo evaluate the expression level of hepatic miR-223, quantitative RT-PCR was performed using the Lightcycler-Faststart DNA master SYBR green I PCR kit(Roche, Indianapolis,IN)in a Lightcycler 1.2RealTime PCR System(Roche)according to the operator’s manual.All primers used in this study were designed with the Primer Premier5.0software(Premier,Canada)and synthesized at Invitrogen Inc.(Carlsbad,CA).The miRNA sequence for miR-223is50-TGTCAGTTTGTCAAATACCCC-30.The forward primer for application is50-GCGCTGTCAGTTT GTCAAATAC-30and the reverse primer is50-GTCGTAT CCAGTGCAGGGTCCGAGGTATTCGCACTGGATACG ACggggta-30.The expression level of miR-223in each sample was normalized to the expression level of U6in the same sample by the formula:miR-223/U6¼2ÀD C T;where -D C T=C TmiRNA-C TU6.Prediction of miRNA–mRNA TargetsMiRNA targets can be difficult to identify due to lack of strict base pairing between miRNA and mRNA target sequences.Several computational algorithms including TargetScan[23]and PicTar[24]aid this task by examining base-pairing rules between miRNA and mRNA target sites, location of binding sequences within the target’s30-UTR, and conservation of target binding sequences within related genomes.Genes which were predicted by both TargetScan and PicTar were regarded as potential targets of a certain miRNA.Statistical AnalysisData are expressed as mean±SE.Data were analyzed using SPSS version11.5(SPSS Inc.,Chicago,IL).Dig Dis SciStudent’s t -test was used for comparisons of the data.Pearson’s correlation analysis was used to estimate the relationship between miRNA expression and ischemic injury.P \0.05(2-sided tests)was considered statistically significant.ResultsEvaluation of Ischemic InjuryTo determine the severity of ischemic injury in the mice subjected to 75min of ischemia and 120min of reperfu-sion,serum AST and ALT levels were quantified.A significant increase in serum AST levels were observed in the mice subjected to I/R injury,when compared to the sham-operated mice (2843.3±219.3vs.473.0±57.7IU/l,P \0.01;Fig.1).The same pattern for serum ALT was observed,which was 2468.3±351.1IU/l in the I/R group,compared to 104.3±16.5IU/l in the sham group (P \0.01;Fig.1).To further evaluate the severity of ischemic injury,histological changes in liver tissues were examined.In accordance with our previous study [22],hematoxylin and eosin staining showed that 75min of ischemia and120min of reperfusion caused significant hepatic damage,which manifested primarily as severe sinusoidal conges-tion,cytoplasmic vacuolization,and massive necrosis of parenchymal hepatocytes (Fig.2b).In contrast,no sign of ischemic damage was observed in the sham-operated mice (Fig.2a).Consistent with serum markers of hepatic ischemic injury,histological severity score was signifi-cantly higher in the I/R group when compared to the sham group (2.67±0.21vs.0.17±0.17;P \0.01).Comparison of Hepatic miR-223ExpressionHepatic ischemia triggers a multifaceted cascade of phys-iologic and biochemical events,which involve many genes and proteins [9].To investigate the potential involvement of miR-223in this process,the expression change of hepatic miR-223in response to I/R injury was studied by quantitative RT-PCR in this study.As shown in Fig.3,the expression level of miR-223was significantly up-regulated by more than three-fold in the livers upon I/R injury whenFig.2Histologicalexamination of liver sections.a No histological abnormalities were observed in the sham-operated mice.b Mice subjected to 75min of ischemia followed by 120min of reperfusion had significant hepatic injury,which was characterized by severe sinusoidal congestion,cytoplasmic vacuolization,and massive necrosis of parenchymal.(Original magnification2009)Dig Dis Scicompared to the sham-operated controls(2.59±0.23vs.0.83±0.15;P\0.01).Correlation Analysis of miRNAs Expression and Ischemic InjuryPearson’s correlation analysis was performed to estimate the potential relationship between miR-223expression level and severity of ischemic injury.We observed that miR-223expression level was significantly positively correlated with serum AST and ALT levels(both P\0.01; Fig.4).This result also supported the association between miR-223and ischemic liver injury.MiRNA Target Predicted by Computational Algorithms Identification of miRNA-regulated gene targets is a nec-essary step to understand miRNA functions.By using the prediction algorithm of TargetScan and PicTar,in silico analysis indicated43downstream targets of miR-223that were common to both algorithms.In an effort to further delineate potential downstream targets in hepatic I/R injury,we integrated mRNAfindings from expression profiling with in silico predictions.Microarray analysis of mRNA expression in the same panel of liver samples as studied by mRNA profiling indicated676genes were sig-nificantly down-regulated.Whenfiltering the676down-regulated genes against the43predicted targets,three candidates overlapped between the two series,including acyl-CoA synthetase long-chain family member3 (ACSL3),ephrin A1(EFNA1),and ras homolog gene family member B(RhoB).DiscussionIn this study,we observed that ischemic livers were asso-ciated with significant up-regulation of miR-223 expression;the expression of this miRNA was also observed to be positively correlated with the severity of ischemic injury.These results provided evidence that miR-223may be somehow involved in the process of hepatic I/R injury.Hepatic I/R injury is a complex physiological process that is associated with the interaction of many genes and proteins[10–12,25].MiRNAs are known to be important mediators of gene regulation in response to cell-to-cell signaling and act in negative feedback of gene regulation [26].Profound regulatory roles of miRNAs in various liver diseases have been reported in recent studies[14–17].The observations of this study also gave some support to the hypothesis that hepatic I/R injury is another form of liver disease that might involve miRNAs regulation.Bioinformatic analyses results indicated potential regu-latory mechanisms of miR-223in hepatic I/R injury.Each miRNA is supposed to have many target genes;therefore, the effect of a change in the expression of just a signal miRNA on biological mechanism expression would be expected to be larger than that of a change in a signal mRNA[27].By using the prediction algorithm of Target-Scan and PicTar,we noticed that43genes were predicted to be potential downstream targets of miR-223that were common to both algorithms.Among these genes,ACSL3, EFNA1,and RhoB were also observed to be significantly down-regulated by our microarray analysis of mRNA expression in the same panel of liver samples.This indi-rectly confirmed the results of bioinformatic analyses.ACSL3is a member of the enzyme family that catalyzes the synthesis of acyl-CoA using long-chain fatty acids, ATP,and CoA as their substrates[28].Up-regulation of miR-223expression in ischemic livers may result in sig-nificant inhibition of ACSL3,thereby reducing synthesis of acyl-CoA.This hypothesis is partially supported by our recent observation that global metabolic activity was reduced in livers upon I/R injury[22].EFNA1could reg-ulate expression of hypoxia-inducible transcription factor-2alpha[29],which is reported to play a protective role against ischemic damage and oxidative stress[30].Reduced EFNA1expression caused by over-expression of miR-223 may result in decreased expression of hypoxia-inducibleDig Dis Scitranscription factor-2alpha,thereby participating in hepatic I/R injury.The role of RhoB in ischemic liver disease has not been studied so far;thus,further research in this area might uncover novel mechanisms of hepatic I/R injury.In summary,we provide evidence that miR-223might be involved in the process of hepatic I/R injury.Further insight into the regulatory role of this miRNA will not only enhance our understanding of molecular mechanisms of hepatic I/R injury,but also provide new therapeutic targets as the function of specific miRNA can be manipulated through delivery of miRNA mimics.Acknowledgments The authors thank Ms.Qiao-Juan Shi for her help in animal experiments and Drs.Li-Ming Xu and Ding Wei for their assistance in histological analysis.This study was supported by the National Natural Science Foundation of China(No.30571804). References1.Selzner N,Rudiger H,Graf R,Clavien PA.Protective strategiesagainst ischemic injury of the liver.Gastroenterology.2003;125:917–936.doi:10.1016/S0016-5085(03)01048-5.2.Serracino-Inglott F,Habib NA,Mathie RT.Hepatic ischemia-reperfusion injury.Am J Surg.2001;181:160–166.doi:10.1016/ S0002-9610(00)00573-0.3.Xu C,Yu C,Li Y.Current studies on therapeutic approaches forischemia/reperfusion injury in steatotic livers.Hepatol Res.2008;38:851–859.doi:10.1111/j.1872-034X.2008.00354.x.4.Huguet C,Gavelli A,Bona S.Hepatic resection with ischemia ofthe liver exceeding one hour.J Am Coll Surg.1994;178:454–458.5.Fondevila C,Busuttil RW,Kupiec-Weglinski JW.Hepaticischemia/reperfusion injury—a fresh look.Exp Mol Pathol.2003;74:86–93.doi:10.1016/S0014-4800(03)00008-X.6.Busuttil RW,Tanaka K.The utility of marginal donors in livertransplantation.Liver Transpl.2003;9:651–663.doi:10.1053/jlts.2003.50105.7.Chan EY,Larson AM,Gernsheimer TB,et al.Recipient anddonor factors influence the incidence of graft-vs.-host disease in liver transplant patients.Liver Transpl.2007;13:516–522.doi:10.1002/lt.21082.8.Verran D,Kusyk T,Painter D,et al.Clinical experience gainedfrom the use of120steatotic donor livers for orthotopic liver transplantation.Liver Transpl.2003;9:500–505.doi:10.1053/jlts.2003.50099.9.Banga NR,Homer-Vanniasinkam S,Graham A,Al-Mukhtar A,White SA,Prasad KR.Ischaemic preconditioning in transplan-tation and major resection of the liver.Br J Surg.2005;92:528–538.doi:10.1002/bjs.5004.10.Defamie V,Cursio R,Le Brigand K,et al.Gene expression pro-filing of human liver transplants identifies an early transcriptional signature associated with initial poor graft function.Am J Transpl.2008;8:1221–1236.doi:10.1111/j.1600-6143.2008.02249.x. 11.Borozan I,Chen L,Sun J,et al.Gene expression profiling of acuteliver stress during living donor liver transplantation.Am J Transpl.2006;6:806–824.doi:10.1111/j.1600-6143.2006.01254.x.12.Navarro-Sabate A,Peralta C,Calvo MN,et al.Mediators of ratischemic hepatic preconditioning after cold preservation identi-fied by microarray analysis.Liver Transpl.2006;12:1615–1625.doi:10.1002/lt.20863.13.Bartel DP.MicroRNAs:genomics,biogenesis,mechanism,andfunction.Cell.2004;116:281–297.doi:10.1016/S0092-8674(04) 00045-5.14.Budhu A,Jia HL,Forgues M,et al.Identification of metastasis-related microRNAs in hepatocellular carcinoma.Hepatology.2008;47:897–907.doi:10.1002/hep.22160.15.Murakami Y,Yasuda T,Saigo K,et prehensive analysisof microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues.Oncogene.2006;25:2537–2545.doi:10.1038/sj.onc.1209283.16.Shan Y,Zheng J,Lambrecht RW,Bonkovsky HL.Reciprocaleffects of micro-RNA-122on expression of heme oxygenase-1 and hepatitis C virus genes in human hepatocytes.Gastroenter-ology.2007;133:1166–1174.doi:10.1053/j.gastro.2007.08.002.17.Moffat ID,Boutros PC,Celius T,Linden J,Pohjanvirta R,OkeyAB.MicroRNAs in adult rodent liver are refractory to dioxin treatment.Toxicol Sci.2007;99:470–487.doi:10.1093/toxsci/ kfm189.18.Girard M,Jacquemin E,Munnich A,Lyonnet S,Henrion-CaudeA.miR-122,a paradigm for the role of microRNAs in the liver.JHepatol.2008;48:648–656.doi:10.1016/j.jhep.2008.01.019. 19.Fukao T,Fukuda Y,Kiga K,et al.An evolutionarily conservedmechanism for microRNA-223expression revealed by microR-NA gene profiling.Cell.2007;129:617–631.doi:10.1016/j.cell.2007.02.048.20.Johnnidis JB,Harris MH,Wheeler RT,et al.Regulation of pro-genitor cell proliferation and granulocyte function by microRNA-223.Nature.2008;451:1125–1129.doi:10.1038/nature06607. 21.Wong QW,Lung RW,Law PT,et al.MicroRNA-223is com-monly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1.Gastroenterology.2008;135:257–269.doi:10.1053/j.gastro.2008.04.003.22.Xu C,Zhang X,Yu C,Lu G,Chen S,Xu L,Ding W,Shi Q,Li Y.Proteomic analysis of hepatic ischemia/reperfusion injury and ischemic preconditioning in mice revealed the protective role of ATP5b.Proteomics.2008.(in press).doi:10.1002/pmic.200800393.23.Lewis BP,Shih IH,Jones-Rhoades MW,Bartel DP,Burge CB.Prediction of mammalian microRNA targets.Cell.2003;115: 787–798.doi:10.1016/S0092-8674(03)01018-3.24.John B,Enright AJ,Aravin A,Tuschl T,Sander C,Marks DS.Human microRNA targets.PLoS Biol.2004;2:e363.doi:10.1371/ journal.pbio.0020363.25.Vascotto C,Cesaratto L,D’Ambrosio C,et al.Proteomic analysisof liver tissues subjected to early ischemia/reperfusion injury during human orthotopic liver transplantation.Proteomics.2006;6:3455–3465.doi:10.1002/pmic.200500770.26.Carthew RW.Gene regulation by microRNAs.Curr Opin GenetDev.2006;16:203–208.doi:10.1016/j.gde.2006.02.012.27.Fukushima T,Hamada Y,Yamada H,Horii I.Changes of micro-RNA expression in rat liver treated by acetaminophen or carbon tetrachloride—regulating role of micro-RNA for RNA expres-sion.J Toxicol Sci.2007;32:401–409.doi:10.2131/jts.32.401. 28.Fujimoto Y,Itabe H,Kinoshita T,et al.Involvement of ACSL inlocal synthesis of neutral lipids in cytoplasmic lipid droplets in human hepatocyte HuH7.J Lipid Res.2007;48:1280–1292.doi:10.1194/jlr.M700050-JLR200.29.Yamashita T,Ohneda K,Nagano M,et al.Hypoxia-inducibletranscription factor-2alpha in endothelial cells regulates tumor neovascularization through activation of ephrin A1.J Biol Chem.2008;283:18926–18936.doi:10.1074/jbc.M709133200.30.Kojima I,Tanaka T,Inagi R,et al.Protective role of hypoxia-inducible factor-2alpha against ischemic damage and oxidative stress in the kidney.J Am Soc Nephrol.2007;18:1218–1226.doi:10.1681/ASN.2006060639.Dig Dis Sci。