Chapter 8 transcription in prokaryotes

How to recognize the specific promoter ?

σ factor is critical in promoter recognition, by decreasing the affinity of the core enzyme for non-specific DNA sites (104) and increasing the affinity for the corresponding promoter (103).
(2) β and β’subunit


β is encoded by rpoB gene, and β ’ is encoded by rpoC gene . Make up the catalytic center of the RNA polymerase
βsubunit The β subunit can be crosslinked to the template DNA, the product RNA, and the substrate ribonucleotides; β subunit may contain two domains responsible for transcription initiation and elongation
2. Differences Between transcription and replication
(1) using one of the two DNA strands as a template. (asymmetrical transcription) (2) The substrates are NTP (3) No free 3’-OH end needed for initiation. No primer needed. (4) DNA-RNA duplex less stable than DNA-DNA duplex. RNA falls away from transcription site. (5) RNA polymerase catalyzes the reaction. Less accurate (error rate: 10-4) (6)Transcription selectively copies only certain parts of the genome
Upstream Downstream +1 sequences (~ -1) sequences (+1 ~) Transcription initiation site
Transcription initiation site A specific nucleotide of the gene sequence corresponding to the first base incorporated into RNA is called the start site and is designated as +1.
8.1 an overview
1. Definition: describes synthesis of RNA on a DNA template.
template substrate enzyme product Base pair direction primer one of the two DNA strands NTP RNA polymerase mRNA, tRNA, rRNA，small RNA A-U, G-C 5’ → 3’ No primer needed
…AAGCGCCGCCGGCGCTTTTTT… Coding strand …TTCGCGGCGGCCGCGAAAAAA… Template strand
…AAGCGCCGCCGGCGCUUUUUU… RNA
The only difference among DNA sense strand and RNA transcript is a base substitution (T or U), which is the base of gene prediction from DNA sequence
Chapter 8
Transcription in prokaryotes
The Central Dogma
DNA
replication Transcription
RNA
Translation
Protein

Contents

Basic principles of transcription Escherichia coli RNA polymerase The E. coli σ70 promoter Transcription process
2. σ70 promoter
(1) size: a sequence of between 40 and 60 bp -55 to +20: bound by the polymerase -20 to +20: tightly associated with the polymerase and protected from nuclease digestion by DNaseΙ
8.3 The E. coli σ70 promoter
1. Overview of promoter (1) definition: A DNA sequence to which RNA polymerase binds to initiate transcription.
promoter
terminator
promoter
Start site
terminator
(~ -1) upstream sequence
+1
Downstream sequence (+1 ~)
The start site Is a purine in 90% of all gene G is more common at position +1 than A There are usually a C and T on either side of the start nucleotide (i.e. CGT or CAT)
3. Transcription unit
A region of DNA bounded by a promoter and a terminator that is transcribed as a single unit; may include more than one gene.
promoter Transcribed region terminator
8.2 E. coli RNA polymerase
1. Activity of RNA polymerase (1) Requires no primer for polymerization (2) 5’ → 3’synthesis (3) Require Mg2+ for RNA synthesis activity (4) RNA synthesis rate: 40 nt per second at 37oC (5) lacks 3’ → 5’exonuclease activity, and the error rate of nucleotides incorporation is 10-4 to 10-5.
ω
α
Initiation only
σ
β’
Both initiation & elongation
(1) αsubunit
Two identical subunits in the core enzyme Encoded by the rpoA gene Required for assembly of the core enzyme Plays a role in promoter recognition. plays a role in the interaction of RNA polymerase with some regulatory factors
factor in promoter recognition
Different factors
Many prokaryotes contain multiple σ
factors to recognize different promoters. The most common σ factor in E. coli is σ70.
2. Composition of E. coli RNA polymerase
The complete enzyme, consisting of the core enzyme plus the σ factor, is called the holoenzyme. Core enzyme
β α
(3) Sigma factor
σis encoded by the rpoD gene. Binding of the σ factor converts the core RNA pol into the holoenzyme. Function: promoter recognition σ factor is not required for transcription elongation and after initiation (RNA chain is 8-9 nt) it is released from the RNA pol . Sigma factor can be reused by different core polymerase.
β’ subunit 2+ ions and may participate in Binds two Zn the catalytic function of the polymerase β’ subunit may be responsible for binding to the template DNA .