法医学SNP检测新方法研究

A new PCR- Ligase Detection Reaction (LDR) system forforensic SNP analysisLiang Weibo, Lv Meili, Liao Miao, Wang Zhuo, Wang Yanyun, Zhang Lin sichuan university college of basic clinical medicine and forensic science,Chengdu (610041)AbstractForensic DNA analysis is routinely performed using polymorphic short tandem repeat (STR) markers. Nevertheless, for degraded or minute DNA samples, analysis of autosomal single nucleotide polymorphisms (SNPs) in short fragments might be more successful. Furthermore Y-chromosomal SNPs analysis is a more useful tool in forensic investigations. Recently most methods of SNPs typing are based on the principle of minisequencing. Here we developed a new SNPs detection system for limited forensic materials based on the Ligase Detection Reaction (LDR) assay. A set of 8 Y-SNPs have been typed in 232 individuals of two different Chinese populations via multiplexed Ligase Detection Reaction assay through the Applied Biosystem 310 after the multiplexed PCR. Three probes for each Y-SNP were designed including one common fluorescence labeled probe and two allele specific probes different in size. All the amplicons are less than 100 bps for easy detection degraded or minute DNA samples. Even though the number of markers in the current system is limited, it can easily be extended to yield a greater power of discrimination. When fully developed, the PCR-LDR analysis provides a promising system for efficient sensitive SNP analysis of forensic samples in the future. Keywords: LDR forensic snp Y-snp1. IntroductionY-chromosomal single nucleotide polymorphisms (Y-SNPs) are mostly used in molecular anthropology for evolutionary research up to now. Because of their low discrimination power, these markers have an important disadvantage against the STRs in routine case work so far [1]. To achieve similar evidence, it is necessary to analyze a larger set of polymorphic SNPs in a population. However, several Y-SNPs could be also useful for forensic purposes.The detection of haplogroups can give additional information for crime investigations [2]. Although the number of haplogroups is relatively small, they can provide powerful and simple exclusion tools in forensic analysis as their populationspecificity may allow to determine the origin of a male lineage [1]. In the field of forensic routine, methods for genotyping Y-SNPs have to comply with strong quality requirements. In particular, high efficiency in the analysis of minimal DNA-amounts, extremely high reliability, automation and high- throughput capability as well as cost-efficient tests are important in forensic work [2~6]. In our study, a new method for SNPs detection system for limited forensic materials based on the Ligase Detection Reaction (LDR) assay are introduced. Ligase Detection Reaction (LDR) utilizes the ability of DNA ligaseto preferentially seal adjacent oligonucleotides hybridized to target DNA in which there is perfect complementation at the nick junction[7].Figure 1: LDR Typing of a G T SNP.The allelic probe corresponding to the wildtype allele is shown in blue and has a G at its 3´ end.The common probe is shown in bold black. In this example, the template has been amplified froman individual homozygous for the wildtype G allele. Thus only the wildtype allelic probe is ligated to the common probe, generating a single type of ligation product. The thermal cycling is repeateda few times in order to generate sufficient ligation product for detection.2. Material and methods2.1 DNA extractionSamples from routine case work were analysed. The population samples include individuals fromtwo different groups including Nanjing han population(n =120) and Chengdu hanpopulation(n=112). Extraction and DNA quantification methods were previously described[11].2.2 Multiplex PCR amplificationA set of 8 binary markers (m9,m74, m35, m95, m110, m89,m13, m20) was amplified by twomultiplex PCR system. Pairs of primers were described in table 1. The PCR performed by Qiagenhot star Taq DNA polymerase PCRsystem. PCR conditions began at 95◦C for 15 min, followed by32 cycles consisting of30 s at 94◦C, 1min at 56◦C, 1min at 72◦C, followed by a 7 min extention at72◦C.Table 1 Primer sequences of 8 binary markers2.3 Multiplexed LDRThe amplified products were treated with shrimp alkaline phosphatase (SAP) and exonuclease ISequences of primersM74 GGTTTTCAATATTAACTAGGAAAGTCTG TCTTTTGCTGCTGTTGTCTTTTM35AGGGCATGGTCCCTTTCTAT TGGGTTCAAGTTTCCCTGTC M95 TGAACCCCACTTTCACAACA GTTGTGAGGTCCTTCCCAGAM110 CGAGAACGTTCCTGTCACAA TTTTCCCCGTCCTAAAGTCC M89 CTATGAGGTGCCATGAAAGTG TGTGAAGTCTTGGCAGAATAGM13 TAGTTTATGCCCAGGAATGAAC ATCCAACCACATTTGCAAAA M20 AGTTGGCCCTTTGTGTCTGT CATGTTCAGTGCAAATGCAAC(EXO I) treatment to avoid participation of remaining dNTPs and primers in the ligase detection reactions. The sequences of the SNaPshot primers are reported in Table 2.Table 2 The probes of ligase detection reactions of 8 SNPsM9_modify P-ATTCAACCATCTTAGGCCGTTTCTTTTTTTTTTTTTTTTTT-FAMM9_C TTTTTTTTTTTTTTTTTCTAAATTAAAGAAAAATATAGAGGM9_G TTTTTTTTTTTTTTTTTTTTCTAAATTAAAGAAAAATATAGAGCM74_modify P-ACCAGTTTTTAAAATACCTAATCTATTTTTTTTTTTTTTTTTTT-FAM M74_A TTTTTTTTTTTTTTTTTTTCTTACTTAAAGCAACTTAA T AATGTM74_G TTTTTTTTTTTTTTTTTTTTTTCTTACTTAAAGCAACTTAA T AATGCM110_modif y P-AATACATTGTACCGGCATCCTGCCTTTTTTTTTTTTTTTTTTTTTTT-F AMM110_T TTTTTTTTTTTTTTTTTTTTTTTAATGCAACAGTTTACAAG T ACATAM110_C TTTTTTTTTTTTTTTTTTTTTTTTTTAATGCAACAGTTTACAAG T ACATGM35_modify P-CAGTGTCCCAAAGGAAAATTGGGACTTTTTTTTTTTTTTTTTTTTTTT TT-FAMM35_G TTTTTTTTTTTTTTTTTTTTTTTTTACTTTCGGAGTCTCTGCCT C TGTCCM35_C TTTTTTTTTTTTTTTTTTTTTTTTTTTTACTTTCGGAGTCTCTGCCT C TGT CGM89_modify P-AGATTTTTGTACATAACCTTAGGAATTTTTTTTTTTTTTTT-FAM M89_C TTTTTTTTTTTTTTTTTGCAACTCAGGCAAAGTGA C AGATGM89_T TTTTTTTTTTTTTTTTTTTTGCAACTCAGGCAAAGTGA C AGATAM95_modify P-CACTAATATGGTAGTCTTTCCTTATTTTTTTTTTTTTTTTTTTTTTT-FA MM95_C TTTTTTTTTTTTTTTTTTTTTTAGGTTGGAAAGGCTAAGCC T TCCAGM95_T TTTTTTTTTTTTTTTTTTTTTTTTTAGGTTGGAAAGGCTAAGCC T TCCAAM13_modify P-AAGGGCAGTAGGTAGGTTAAGGGCAAGACGGTTATTTTTTTTTTTT TTTTTT-FAMM13_G TTTTTTTTTTTTTTTTTTTTTTGGCAGTAGGTAGGTTAAGGGCAACM13_C TTTTTTTTTTTTTTTTTTTTTTTTTTTGGCAGTAGGTAGGTTAAGGGCA AGM20_modify P-ACATTTGTAGGTTCAACCAACTGTGGATTGAAAAT-FAMM20_A TTTTTTTTTTTTTTTTTTTAATATGGTAGTCTTTCCGAATM20_G TTTTTTTTTTTTTTTTTTTTTTTTTAATATGGTAGTCTTTCCGAAC The ligase detection reaction were performed by 35cycles (94 for 30s followed 60 for 2mins )of ligation℃℃reactions began with 94 for 2 mins.℃3. Results3.1The figure 2 shows the productes of two multiplex PCR amplifications, the 8 snps have been divided into two groups to amplified, the product size form 80～300bp.In figure, products of five individuals were shown, from 1 to 5 products were loci of m9,m74, m35, m95, and the products of6 to 10 were loci of m110, m89,m13, m20.Figure 2 the productes of two multiplex PCR amplifications3.2 The table 3 compromised the results of 8 SNPs in 2 chinese populations .Table 3 Results of 8 SNPs typing by LDR systemFrequncesvariationY-SNP SequenceNanjin(n=120) Chengdu(n=112) M9 C/G 105/15103/987.5%92.0%M74 A/G 113/7 94.2% 105/7 93.8%M35G/C 116/4 96.7% 110/2 98.2%M95 C/T 120/0 100% 112/0 100%M110 T/C 120/0 100% 112/0 100%M89 C/T 103/1787.5%98/1485.8%M13 G/C 107/1389.2%101/1190.2% M20 A/G 112/8 93.3% 105/7 93.8% 4. DisscussionThe presented study shows that genotyping of Y-SNPs is also suitable for forensic case work.Although the discrimination power of the SNPs is not as high as of the Y-STRs, the detection ofthe haplogroups can give additional information in the routine of criminalistics to identifiy anunknown body or perpetrator. High throughput methods with multiplexes of a large number ofmarkers and an informative panel of Y-SNPs could have the potential to replace STRs in future. A special advantage of the SNPs is the very short length of the fragments, what is very important in particular for the analysis of degraded DNA. Even though the number of markers in the currentsystem is limited, it can easily be extended to yield a greater power of discrimination. When fully developed, the PCR-LDR analysis provides a promising system for efficient sensitive SNPanalysis of forensic samples in the future.References1 M.A. Jobling, Y-chromosomal SNP haplotype diversity in forensic analysis, For. Sci. Int. 118 (2001) 158–162.2 R. Lessig, Y-chromsomale DNA-polymorphismen, Med. Diss. Habil. Univ., Leipzig, 2004.3 M. Kayser, S. Brauer, G.Weiss, P.A. Underhill, L. Roewer,W.Schiefenho¨vel, M. Stoneking, Melanesian origin of Polynesian Y-chromosomes, Curr. Biol. 10 (2000) 1237–1246.4 R. Lessig, J. Edelmann, M. Zoledziewska, etc. SNP-genotyping on human Y-chromosome for forensic purposes—comparison of two different methods, in Progress in Forensic Genetics 10, Elsevier, Amsterdan, 2004, pp. 334–336.5 L. Roewer, M. Krawczak, S.Willuweit, etc. Online reference database of Y-chromosomal short tandem repeat (STR) haplotypes, For. Sci. Int. 118 (2001) 106–113.6 The Y-chromosome consortium, A nomenclature system for the tree of human Y-chromosomal binary haplogroups, Genome Res. 12 (2002) 339–348.7 Busti E, Bordoni R, Castiglioni B, et al G Bacterial discrimination by means of a universal array approach mediated by LDR. BMC Microbiol, 202, 2-27。