2011二粒小麦抗旱蛋白2.78

Research articleThe drought response displayed by a DRE-binding protein from Triticum dicoccoidesStuart Lucas,Emel Durmaz,Bala An ıAkp ınar,Hikmet Budak *Sabanci University,Biological Sciences and Bioengineering Program,34956Tuzla,Istanbul,Turkeya r t i c l e i n f oArticle history:Received 23July 2010Accepted 11January 2011Available online 21January 2011Keywords:Drought stressWild emmer wheatPutative transcriptional activator DREB AP2domaina b s t r a c tDrought is one of the major causes of dramatic yield loss in crop plants.Knowledge of how to alleviate this loss is still limited due to the complexity of both the stress condition and plant responses.Wild emmer wheat (Triticum turgidum ssp.dicoccoides )is a potential source of important drought-resistance genes for its cultivated relatives.The gene for an emmer DRE-binding protein,TdicDRF1,was cloned and shown to be drought-responsive with orthologs in other plants.This is the first report of the cloning of TdicDRF1,and its expression was further characterized by RT-PCR in both drought-sensitive and drought-resistant accessions of Triticum dicoccoides .Analysis of the AP2/ERF DNA-binding domain of TdicDRF1as a GST-fusion protein and its binding to DRE by electrophoretic mobility shift assay (EMSA)indicate functional differences between wheat DREBs and those characterized in Arabidopsis thaliana .DREB expression increased in drought-stressed roots,correlating with the RT-PCR results,but not in leaf,showing that tissue-speci fic regulation occurs at the protein level.Hence,the DREB e DRE interaction undergoes subtle multi-level regulation.Ó2011Elsevier Masson SAS.All rights reserved.1.IntroductionImproving the yield of crops under environmental stress is one of the major challenges facing modern agriculture.Climate change,human population growth and increasing pressure on land and water resources demand the development of crop strains that remain productive under conditions such as restricted water supply and high salt.Unfortunately,centuries of selective breeding under optimal environmental conditions has eliminated stress tolerance alleles from today ’s elite cultivars,although they may still occur in wild relatives [19].Wild emmer wheat (Triticum turgidum ssp dicoccoides )is a largely untapped source of such alleles for its close relatives,durum and bread wheats.In recent years a considerable number of plant genes involved in drought and salt tolerance have been identi fied (reviewed in [2]).While many encode proteins that directly produce tolerance effects in the plant cell,some of the key players are transcription factors that govern the expression of these effectors [22],including those that bind to the dehydration responsive element,DRE.This 9-bpconsensus sequence,TACCGACAT,was first identi fied in the promoter of Arabidopsis rd29A/lti78and shown to be essential for drought induction in the absence of abscisic acid [21].Subsequently a family of transcription factors were found to bind to this element and therefore named DRE-binding (DREB)proteins [13].In Arabi-dopsis there are 2DREB subfamilies distinguished both by their sequence and their expression characteristics.The DREB1proteins are upregulated in response to cold stress,while DREB2proteins are activated primarily by dehydration or high salt.The presence of multiple DREBs responding to different stresses explains how genes such as rd29A can be differentially regulated through the same cis -acting element.All DREBs contain a conserved AP2DNA-binding domain,which was first identi fied in the developmental gene APETALA2[10]and is also present in ethylene-responsive element binding proteins [16].While the AP2domain sequence is largely conserved,Sakuma et al.[17]found that residues Val-14and Glu-19in DREB AP2domains distinguish them from other AP2domains and confer speci fic binding to DRE.Following these findings DREBs have been identi fied by homology in many other plant species [1].We used a putative DREB sequence labelled DREB3A from Triticum aestivum (Ta DREB3A,Genbank ID:AY781349)to isolate a DREB from wild emmer wheat,T.turgidum ssp dicoccoides ,and investigate its role in the greater drought tolerance of this subspecies compared to cultivated wheats.Abbreviations:DRE,dehydration-responsive element;CBF/DREB,C-repeat/dehydration-responsive element binding factor;RT-PCR,reverse transcription PCR;qRT-PCR,quantitative (real-time)RT-PCR;EMSA,electrophoretic mobility shift assay.*Corresponding author.Tel.:þ902164839575;fax:þ902164839550.E-mail address:budak@ (H.Budak).Contents lists available at ScienceDirectPlant Physiology and Biochemistryjournal h omepage:www.elsevier.co m/locate/plaphy0981-9428/$e see front matter Ó2011Elsevier Masson SAS.All rights reserved.doi:10.1016/j.plaphy.2011.01.016Plant Physiology and Biochemistry 49(2011)346e 3512.Materials and methods2.1.Plant growth and stress treatmentsFor hydroponic growth,T dicoccoides seeds were surface steril-ized with1%NaOCl and then germinated for5days in Perlite moistened with saturated CaSO4.Seedlings were transferred to continuously aerated Hoagland’s solution and grown under controlled conditions modified from those described previously [5]:24e26 C,relative humidity60e70%,under a16-h photoperiod under a photonflux density of600e700m mol mÀ2sÀ1.After14 days plants were drought shocked by removing them from the growth medium and placing them on a sterile dish in the light for 8h,after which they were immediatelyflash frozen in liquid nitrogen and stored atÀ80 C.T.dicoccoides genotypes Tr39477and Ttd22were previously characterized in a screen of about200T.dicoccoides accessions described by Ergen and Budak[7].Based on plant appearance and physiological measurements,they were the most tolerant line and the most sensitive line respectively to water stress.Greenhouse growth was carried out as outlined previously[7]; for each accession six pots were planted with4germinated seeds, and kept well-watered for4weeks while randomly changing the position of the pots.Drought stress was initiated by withholding water from3of the pots for9days.After7and9days,root,shoot and leaf tissues were pooled from all plants in one pot for each genotype and condition,flash frozen in liquid nitrogen and stored atÀ80 C.2.2.RNA isolation and cloningTotal RNA was collected from frozen plant tissues using Trizol (Invitrogen)extraction as previously described[8],and RNA integrity confirmed by observation of the rRNA bands on an agarose gel.First strand cDNAs were synthesized using oligo-dT primers. The following primer pairs were designed to amplify close homo-logs of Ta DREB3a:FP1e GAAGTGAACCAACAACTGGA and RP1e CCACGTACAACACCTTCAAT to amplify the AP2domain with short flanking sequences,for protein expression;FP2e TTCCGTGGTGT AAGGCAA and RP2e ATACATTGCTCTGGCTGCCT within the AP2 domain,as this is the most highly conserved part of DREB genes and so most certain to detect homologous sequences;3F e ATGACGGT AGATCGGAAG and3R e ACAACCCTTCGAAGAACT to amplify the entire coding sequence of any transcripts closely matching Ta DREB3a(Fig.1b).PCR products were TA cloned into vector pCR2.1 (Invitrogen)and sequenced.2.3.RT-PCR analysisFor semi-quantitative PCR,RNA concentrations were measured using a Nanodrop spectrophotometer and equimolar amounts of each sample were used as a template forfirst-strand cDNA synthesis using oligo-dT primers and Mu-MLV Rnase H-reverse transcriptase (Promega)according to the manufacturer instructions.cDNAs derived from TdicDRF1were amplified using the primers above and products analyzed after27,31and35cycles.As internal reference primers GTGACGGGTGACGGAGAATT and GACACTAATGCGCCCGG-TAT designed against T.aestivum18S rRNA(Genbank ID:AJ272181) were amplified using the same conditions.2.4.Expression of the recombinant DNA binding domainof the DREB3The sequence of the TdicDRF1AP2domain amplified by primers FP1and RP1was subcloned into the pGEX-4t-2expression vector and used to transform Escherichia coli strain DH5a.Following induction by IPTG,bacteria were lysed and the fusion protein purified using GST-sepharose beads.Homogeneity and abundance of the purified proteins were confirmed by SDS and native8% polyacrylamide gel electrophoresis,and by immunoblotting with anti-GST-HRP conjugate(GE Healthcare RPN1237)at the recom-mended dilution of1:5000.2.5.Gel mobility shift assayElectrophoretic mobility shift assays(EMSA)were carried out using the LightShift Chemiluminescent EMSA kit(Pierce).Double-stranded DNA probes for binding to the recombinant protein described above were produced as follows.A139bp fragment of the50UTR of Arabidopsis thaliana rd29A was PCR amplified using the following primers:wtDREf:GATATAC T ACC G ACA T GAGTTCC AAAAAGC(DRE sequence highlighted)and DREr:AGAGACTGAGA-GAGATAAAGGGACA.Point mutations were introduced using mDRE primers with the same sequence as wtDREf apart from a single base substitution at one of the underlined residues.All PCR products were cloned into pCR2.1and sequenced.Correct sequences were excised using Bst X I to give4base30overhangs and labelled with biotin(Biotin30End DNA labeling kit,Pierce).Plant nuclear extracts were prepared as described[9]and probes prepared by obtaining71-bp long sense and antisense oligonucleotides spanning the DRE sequence,separately labeling their30ends and then annealing them together.Each binding reaction was carried out using0.1m g of probe DNA.Products were separated on an8%native polyacrylamide gel,transferred onto nylon membrane and visualised using streptavidin e HRP conjugate and chemiluminescence reagents according to the manufacturer petition and supershift were demonstrated using unlabeled WT DRE probe DNA and anti-GST-HRP antibody respectively.2.6.BioinformaticsSequence similarity searches were carried out using BLASTN v2.2.22at the NCBI website[23].Multiple sequence alignments were calculated and displayed using ClustalX v.2.0.12[3,4,11].3.Results3.1.Isolation and cloning of a T.dicoccoides DREBIn order to identify a novel DREB from T.dicoccoides,we used the Conserved Domain Database[14]to identify the AP2domain of Ta DREB3A,as this domain is highly conserved between DREBs of different species[18].PCR primers both within andflanking the AP2domain were designed.Both amplified efficiently from T.dicoccoides cDNA,suggesting that this species contains a close homolog of Ta DREB3A.Therefore further primers were designed to amplify the entire open-reading frame.Both the full-length and AP2motif products were cloned and sequenced(Fig.1).Using the coding sequence,a BLAST search identified close matches in other crop species:Triticum durum DRF1(99%identity), T.aestivum Wdreb2(94%)and Hordeum vulgare DRF1(93%).Align-ment of the predicted protein sequences(Fig.1a)showed that the T.dicoccoides DREB contains2amino acid substitutions compared to Ta DREB3A,and one further amino acid change compared to TdDRF1. TdDRF1,Wdreb2and HvDRF1have all been reported to produce3 different RNA transcripts by alternative splicing[6,12,20],with one or two additional exons being inserted just prior to the putative nuclear localization pared to the T.dicoccoides DREB, Ta DREB3A contains a47-residue insertion at the same location,andS.Lucas et al./Plant Physiology and Biochemistry49(2011)346e351347has an alternative splice variant which lacks this insertion (Ta DREB3B,Genbank ID:AY781350).To minimise confusion of nomenclature,the T.dicoccoides gene has been labelled TdicDRF1.The TdicDRF1cDNA sequence and the ORFs of the most closely related DREBs from other grasses were analyzed phylogenetically (Fig.1c).While TdicDRF1is most similar to T.aestivum DREB3B,T.aestivum Wdreb2was closer to Aegilops tauschii DRF1,suggesting that in bread wheat these two DREBs are descended from thesameFig.1.Analysis of TdicDRF1sequence.a.Alignment of predicted protein sequences of T.dicoccoides DREB (TdicDRF1)with Ta DREB3A and published DREBs from closely related species:DRF1from T.durum and H.vulgare ,and wDREB2from T.aestivum .The 58bp AP2domain is boxed and the V14and E19residues required for binding to the DRE indicated by arrows.b.TdicDRF1cDNA sequence with AP2domain and PCR primer sites marked.c.Phylogenetic relationship of coding sequences of Wdreb/DRF1orthologs.AtDREB2A was used to root the tree (A.thaliana ,Genbank ID:NM_120623.2).Other accession numbers are:T.aestivum DREB3B ,Genbank ID:AY781350,Wdreb2,Genbank ID:AB193608;DRF1.3from T.turgidum ssp durum ,Genbank ID:EU781993,Aegilops speltoides ,Genbank ID:FJ858187,Ae.tauschii ,Genbank ID:EU197052,H.vulgare ,Genbank ID:AY223807;Leymus chinensis DREB3,Genbank ID:EU999998;O.sativa DREB2B ,Genbank ID:AK099221;Zea mays DREB2A ,Genbank ID:AB218832.Sequence of Brachypodium distachyon 2g29960.2from the US Department of Energy Joint Genome Institute ( ).S.Lucas et al./Plant Physiology and Biochemistry 49(2011)346e 351348ancestral DRF1,one each from its tetraploid and diploid ancestors. All of the orthologs in the phylogenetic tree,except for AtDREB2A, have been shown or are predicted to produce multiple transcripts by alternative splicing,suggesting that this is a conserved feature of DRF1/DREB2in grasses.Therefore we would expect tofind multiple TdicDRF1transcripts as well.3.2.Expression of multiple transcripts of TdicDRF1in response to water stressBoth the full-length ORF and the AP2domain of TdicDRF1were amplified by RT-PCR using cDNA derived from the roots and shoots of control and8h drought-shocked plants.Higher amplification was detected from the drought-shocked plants than controls, indicating that TdicDRF1expression is induced in response to drought(Fig.2a).Amplifying equimolar amounts of total RNA,a more intense band was observed from root than shoot tissue.This indicates that under these rapid drought conditions TdicDRF1is transcribed at higher levels in roots,where drought stress impacts first,than in above ground tissues.To assess the effect of a longer drought period,fresh plants were grown and subjected to9days of slow drought stress.In these experiment samples were collected from2different cultivars previously characterized as drought-resistant(“TR”¼Tr39477)and drought-sensitive(“TS”¼Ttd22)[7].Using primers located in exonsflanking the putative alternative splice site,3different transcripts were amplified semi-quantitatively from drought stressed plants(Fig.2b and c).The coding regions of all3transcripts were cloned and sequenced(Supplementary data,Fig.S1;Genbank ID:HM019503e HM019505).As expected from the DRF1orthologs, the transcript sequences were identical apart from the addition of1 or both of2additional sequence segments after position80oftheFig.2.Differential expression of parison of TdicDRF1expression levels using primers FP2and RP2in control and drought shocked T.dicoccoides after35 cycles of amplification.b e c.Detection of TdicDRF1transcripts in roots(b)and leaves(c)of drought-tolerant and-sensitive T.dicoccoides accessions,using primers3aF and RP1(b)or RP2(c)after35cycles of amplification(at lower cycle numbers,all bands were lower intensity,with the same relative brightness of different bands).As a control,a portion of the 18S rRNA gene was also amplified.d.Sequence polymorphisms found within thefirst81bases of all three transcripts.Type1¼sequence obtained from MM5/4and Ttd22plants. Type2¼sequence obtained from Tr39477plants.Each sequence type was detected in clones derived from at least3independent PCR reactions.S.Lucas et al./Plant Physiology and Biochemistry49(2011)346e351349coding sequence,corresponding to the additional exons reported in DRF1orthologs.The longest and shortest transcripts,TdicDRF1.1 and TdicDRF1.3,were predicted to produce full-length proteins of 388and341amino acids respectively.However,TdicDRF1.2con-tained only thefirst additional exon and this introduced a frame-shift,giving a truncated predicted protein product with only61 amino acids and no AP2domain.Interestingly,TdicDRF1.2appeared to be the most abundant transcript in drought-stressed roots,with similar levels of all3transcripts induced in TR and TS plants.In the unstressed plants,TR roots alone expressed TdicDRF1.3,suggesting that drought-resistant plants express this transcript constitutively (Fig.2b).In leaf tissue transcript levels were lower,only detected under drought stress,and TdicDRF1.1was not reliably detected (Fig.2c).Apart from the sequence insertions found in the longer tran-scripts,two linked polymorphic sites were detected in thefirst81 bases of all3transcripts(Fig.2d),a silent single nucleotide poly-morphism at position24and a four base change at45e48,giving a single residue change in the protein sequence of Ala-17to Thr-17. All transcripts derived from TS plants had the same sequence at these two sites(Type1)while those from TR plants had the other sequence at both sites(Type2).No further polymorphisms were detected in the remainder of the transcript sequences.3.3.Analysis,expression and binding activityof the TdicDRF1AP2domainTdicDRF1and its homologs show almost complete amino acid identity in their AP2domains,including the presence of the14V and19E residues required for DRE-binding specificity(Fig.1a). Between these two the residues AEIR indicate that these are members of the DREB2family[17],and are therefore expected to respond to drought.TdicDRF1has a T to A amino acid substitution4residues before the end of its AP2domain.To determine whether this influences its ability to bind DRE we expressed and purified the AP2domain fused to an N-terminal GST tag.The fusion protein migrated on SDS e PAGE at the expected molecular weight of35kDa (Supplementary data,Fig.S2).Immunoblotting with anti-GST demonstrated the homogeneity of the fusion protein,although a faint band running a little below the major product suggests that some C-terminal degradation may have occurred.Electrophoretic mobility shift assays(EMSA)were used to test the ability of recombinant GST-TdicDRF1-AP2to bind to wild-type DRE(TACCGACAT),and probes mutated at the1st,5th and9th positions.The fusion protein reduced the mobility of the WT DRE probe,was competed out by excess unlabeled probe and gave an increased shift on addition of anti-GST antibody,demonstrating that the mobility shift was caused by specific binding.Mutation of the T in position9of DRE to either G or C abolished binding to the GST-TdicDRF1.In contrast,mutating thefirst T residue to G gave a marked increase in binding,while substituting it with A permitted binding at a similar level to wild-type(Supplementary data,Fig.S3).Mutating the G in the5th position to A or C elimi-nated binding,whereas the probe with T at this position again showed equivalent or better binding than wild-type.Taken together,these results suggest that TdicDRF1binds preferentially to GACCTACAT rather than TACCGACAT.3.4.DRE-binding activity of plant nuclear proteinsThe expression of DRE binding proteins in drought exposed and control tissues was also examined by EMSA using biotinylated probes containing wild-type DRE(Supplementary data,Fig.S4). Nuclear extracts were isolated from root and leaf tissues from control and8h drought stress-treated T.dicoccoides.After an8h drought shock,higher expression of DRE binding proteins was detected in the root tissue(Supplementary data,Fig.S4),corre-lating with the RT-PCR analysis.As with the TdicDRF1transcript levels,in both stressed and control samples much lower levels of DREB protein were detected in nuclei of leaf tissue than those from roots;a greater amount of nuclear protein from leaves was required to confirm the presence of DREBs.EMSA was also carried out using plants exposed to9days of drought stress(Supplementary data,Fig.S4b).DRE binding factors were again detected in control root tissue and upregulated in response to drought.Once again much weaker signals were obtained from leaf than root.Interestingly,in the drought-stressed leaf,DREB levels did not appear to be higher than in controls,but the probe migrated more slowly,suggesting that after extended drought leaf tissue expresses either different DREBs,a different isoform of the same DREB,or additional factors that form a larger protein complex.4.DiscussionWe present here thefirst DREB gene to be identified in T.dicoccoides(wild emmer wheat).TdicDRF1is a putative homolog of previously published DREBs from H.vulgare[20],T.aestivum[6] and T.durum[12].These three DREBs all undergo alternative splicing by insertion of additional exons prior to the AP2domain, giving transcripts that produce truncated and extended proteins. Our RT-PCR analysis found that TdicDRF1also has multiple tran-scripts,the longer ones having insertions of similar size and at the corresponding position to those described above;therefore we can deduce that these transcripts are similarly produced by alternative splicing.DREB genes from a number of other grass species are predicted to behave in the same way,suggesting that these are all orthologs(Fig.1c).In the case of T.aestivum Wdreb2the transcripts were found to be differentially regulated,with only the transcripts that produce full-length protein being induced by drought stress and having transactivation activity[6].Recently similar results were reported for Oryza sativa DREB2B[15],which was also found to be the only rice DREB both to be induced by abiotic stress and to have DRE transactivation activity.In our case,TdicDRF1.3,a tran-script producing full-length protein,was constitutively expressed in TR(drought resistant)but not TS(drought sensitive)T.dicoc-coides,whereas TdicDRF1.1and the non-functional TdicDRF1.2 transcripts were induced similarly in both lines following drought (Fig.2c).This is thefirst time that DRF1/DREB2expression has been compared between drought sensitive and resistant varieties of the same species,and raises the possibility that differential expression of TdicDRF1.3contributes to the differing drought phenotypes of these two lines,although further experiments are required to test this hypothesis.As T.dicoccoides has a tetraploid genome,we would expect to find2different forms of TdicDRF1,one each from the A and B genomes.We detected2linked polymorphisms in the putativefirst exon of TdicDRF1,in all three transcripts(Fig.2d).Egawa et al.[6] found the same polymorphisms in thefirst exon of T.aestivum Wdreb2,along with a third sequence type incorporating a6-bp deletion at one of the polymorphic sites,and proposed that the3 sequence types corresponded to the A,B&D homoeologous groups of bread wheat.If this is correct,the two reported here would be the A and B sequences;however,as they were cloned from different T.dicoccoides lines,they may also be different alleles of the same gene.The AP2domain of TdicDRF1exhibits slightly different binding specificity from previous studies carried out with DREBs from A.thaliana[17],in which base substitutions could be tolerated atS.Lucas et al./Plant Physiology and Biochemistry49(2011)346e351 350thefirst and last positions of the wtDRE sequence(TACCGACAT)but not thefifth.Our recombinant AP2domain bound the wild-type sequence,but showed increased binding to T1-G and G5-T mutants. Similarly it was found that HvDRF1AP2domain binds preferen-tially to T(A/T)ACCGCCTT[20],suggesting that different species have slightly different optimal DRE sequences.We also found that DREB proteins are more abundant and more strongly upregulated in response to drought in root tissue than leaf, where total DREB protein levels were not significantly increased even though TdicDRF1transcripts were.In addition,the differential expression of TdicDRF1.3was only observed in root tissue.Previous DREB studies have focused on their expression in above-ground tissues,but these differences suggest that elucidating their function in roots is also required to fully characterise the drought response. Moreover,the DRE-binding complex in leaves increased in molec-ular weight following drought stress treatment.Further studies are required to determine whether this corresponds to binding of the larger TdicDRF1.1protein,or a different DRE-binding protein.In summary the DRF1/Wdreb protein is conserved across a wide variety of grass species,induced by drought,and regulated by alter-native splicing in a tissue-specific fashion.Ourfindings indicate that the specificity,expression and regulation of DRF1differ from Arabi-dopsis DREBs,highlighting the need to characterise these proteins in grass species to understand their role in drought tolerance. AcknowledgementsThis work was partially funded by TUBITAK(The Scientific and Technological Council of Turkey).Appendix.Supplementary dataSupplementary data associated with this article can be found in the online version,at doi:10.1016/j.plaphy.2011.01.016. References[1]P.K.Agarwal,P.Agarwal,M.K.Reddy,S.K.Sopory,Role of DREB transcription factorsin abiotic and biotic stress tolerance in plants,Plant Cell Rep.25(2006)1263e1274.[2] D.Bartels,R.Sunkar,Drought and salt tolerance in plants,Crit.Rev.Plant Sci.24(2005)23e58.[3]H.Budak,Z.Kasap,R.C.Shearman,I.Dweikat,U.Sezerman,A.Mahmood,Molecular characterization of cDNA encoding resistance gene-like sequences in Buchloe dactyloides,Mol.Biotech.34(2006)293e301.[4]H.Budak,S.Su,N.Ergen,Revealing constitutively expressed resistance genes inAgrostis species using PCR-based motif-directed RNAfingerprinting,Genetic.Resour.88(2006)165e175.[5]Ö.Cebeci,B.Köktürk,N.Ergen,L.Öztürk,I.Çakmak,H.Budak,Differentialexpression of wheat transcriptomes in response to varying cadmium concentrations,Biol.Plantarum52(2008)703e708.[6] C.Egawa,F.Kobayashi,M.Ishibashi,T.Nakamura,C.Nakamura,S.Takumi,Differential regulation of transcript accumulation and alternative splicing ofa DREB2homolog under abiotic stress conditions in common wheat,GenesGenet.Syst.81(2006)77e91.[7]N.Z.Ergen,H.Budak,Sequencing over13,000expressed sequence tags fromsix subtractive cDNA libraries of wild and modern wheats following slow drought stress,Plant Cell Environ.32(2009)220e236.[8]N.Z.Ergen,G.Dinler,R.C.Shearman,H.Budak,Identifying,cloning andstructural analysis of differentially expressed genes upon Puccinia infection of Festuca rubra var.rubra,Gene393(2007)145e152.[9] B.K.Fiil,J.-L.Qiu,K.Petersen,M.Petersen,J.Mundy,Coimmunoprecipitationof nuclear proteins and Chromatin Immunoprecipitation from Arabidopsis, Cold Spring Harbor Protocols(2008).doi:10.1101/pdb.prot5049.[10]K.D.Jofuku,B.G.W.den Boer,M.Van Montagu,J.K.Okamura,Control of Ara-bidopsis seed andflower development by the homeotic gene APETALA2,Plant Cell6(1994)1211e1225.[11]rkin,G.Blackshields,N.P.Brown,R.Chenna,P.A.McGettigan,H.McWilliam,F.Valentin,I.M.Wallace,A.Wilm,R.Lopez,J.D.Thompson,T.J.Gibson,D.G.Higgins,ClustalW and ClustalX version2.0,Bioinformatics23 (2007)2947e2948.[12] tini,C.Rasi,M.Sperandei,C.Cantale,M.Iannetta,M.Dettori,K.Ammar,P.Galeffi,Identification of a DREB-related gene in Triticum durum and its expression under water stress conditions,Ann.Appl.Biol.150(2007) 187e195.[13]Q.Liu,M.Kasuga,Y.Sakuma,H.Abe,S.Miura,K.Yamaguchi-Shinozaki,K.Shinozaki,Two transcription factors,DREB1and DREB2,with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought-and low-temperature-responsive gene expression,respectively,in Arabidopsis,Plant Cell10(1998)1391e1406.[14] A.Marchler-Bauer,J.B.Anderson,F.Chitsaz,M.K.Derbyshire,C.DeWeese-Scott,J.H.Fong,L.Y.Geer,R.C.Geer,N.R.Gonzales,M.Gwadz,S.He,D.I.Hurwitz,J.D.Jackson,Z.Ke,nczycki,C.A.Liebert,C.Liu,F.Lu,S.Lu,G.H.Marchler,M.Mullokandov,J.S.Song, A.Tasneem,N.Thanki,R.A.Yamashita, D.Zhang,N.Zhang,S.H.Bryant,CDD:specific functional annotation with the Conserved Domain Database,Nucleic Acids Research37 (2009)205e210.[15]S.Matsukura,J.Mizoi,T.Yoshida,D.Todaka,Y.Ito,K.Maruyama,K.Shinozaki,K.Yamaguchi-Shinozaki,Comprehensive analysis of rice DREB2-type genes that encode transcription factors involved in the expression of abiotic stress-responsive genes,Mol.Genet.Genomics283(2010)185e196.[16]M.Ohme-Takagi,H.Shinshi,Ethylene-inducible DNA binding proteins thatinteract with an ethylene-responsive element,Plant Cell7(1995)173e182.[17]Y.Sakuma,Q.Liu,J.G.Dubouzet,H.Abe,K.Shinozaki,K.Yamaguchi-Shinozaki,DNA-binding specificity of the ERF/AP2domain of Arabidopsis DREBs,tran-scription factors involved in dehydration-and cold-inducible gene expression, mun.290(2002)998e1009.[18]Y.-G.Shen,W.-K.Zhang,S.-J.He,J.-S.Zhang,Q.Liu,S.Y.Chen,An EREBP/AP2-type protein in Triticum aestivum was a DRE-binding transcription factor induced by cold,dehydration and ABA stress,Theor.Appl.Genet.106(2003) 923e930.[19]S.D.Tanksley,S.R.McCouch,Seed banks and molecular maps:unlockinggenetic potential from the wild,Science277(1997)1063e1066.[20]G.-P.Xue,C.Loveridge,HvDRF1is involved in abscisic acid-mediated generegulation in barley and produces two forms of AP2transcriptional activators, interacting preferably with a CT-rich element,Plant J.37(2004)326e339. [21]K.Yamaguchi-Shinozaki,K.Shinozaki,A novel cis-acting element in an Ara-bidopsis gene is involved in responsiveness to drought,low-temperature,or high-salt stress,Plant Cell6(1994)251e264.[22]K.Yamaguchi-Shinozaki,K.Shinozaki,Transcriptional regulatory networks incellular responses and tolerance to dehydration and cold stresses,Ann.Rev.Plant Biol.57(2006)781e803.[23]Z.Zhang,S.Schwartz,L.Wagner,ler,A greedy algorithm for aligningDNA sequences,put.Biol.7(2000)203e214.S.Lucas et al./Plant Physiology and Biochemistry49(2011)346e351351。