Two multiplex real-time TaqMan polymerase chain reaction systems for simultaneous detecting Up

Two multiplex real-time TaqMan polymerase chain reaction systems for

simultaneous detecting and serotyping of Ureaplasma parvum

Xuan Cao,Zhiying Jiang,Yefu Wang ?,Rui Gong,Chufu Zhang ?

College of Life Sciences,Wuhan University,Wuhan,Hubei,P .R.China

Received 21November 2006;accepted 23April 2007

Abstract

Studies of epidemiology and pathogenesis of infections with Ureaplasma have received much attention in recent years.Rapid molecular methods for serotyping of Ureaplasma parvum will be of great value in the studies.We developed 2multiplex real-time TaqMan polymerase chain reaction systems that allow simultaneous detecting and serotyping of 4serovars of U.parvum .?2007Elsevier Inc.All rights reserved.

Keywords:Ureaplasma parvum ;Ureaplasma urealyticum ;Real-time TaqMan PCR;TaqMan probe;Standard curve

Ureaplasma urealyticum is a common human pathogen that has been implicated in nongonococcal urethritis and intrauterine infections in association with adverse preg-nancy outcomes such as preterm delivery or stillbirth (Goldenberg and Thompson,2003;Horner et al.,2001;Yoon et al.,2003).Studies of epidemiology and pathogen-esis of infections with Ureaplasma have received much attention in recent years.U.urealyticum consists of 14serovars that can be divided into 2biovars,biovar 1and biovar 2,on the basis of phenotypic and genotypic characteristics.The biovar 1includes 4serovars (serovars 1,3,6,14),whereas the biovar 2comprises 10serovars (serovars 2,4,5,7–13).Evidence has been presented that the species currently known as U.urealyticum should be separated into 2species,namely,Ureaplasma parvum (previously U.urealyticum biovar 1)and U.urealyticum (previously U.urealyticum biovar 2).Most human Urea-plasma isolates belong to the new species U.parvum (Kong et al.,2000).Some Ureaplasma serovars have been associated with disease syndromes more commonly than with normal flora (Zheng et al.,1992).However,these findings are limited and difficult to confirm because of

problems with conventional serotyping methods.Faster and more specific serotyping methods will be of great value in studies of epidemiology and pathogenesis of Ur-eaplasma infections.

Real-time TaqMan polymerase chain reaction (PCR),by sequence-specific TaqMan probes,amplifies and simulta-neously detects a target gene,thus,reducing the chance of cross-contamination and increasing the specificity.The emergence of multicolor detection system enables the detector to collect light from as many as 4fluorophores on the same plate or in each well and separate the signals of the individual fluorophore,which allows monitoring of up to 4amplifications in 1well simultaneously.Real-time TaqMan PCR can be performed in the allelic discrimination format in which the primers and the 2specific probes are contained in one reaction system (Sevall,2001;Yi et al.,2005).The 2sequence-specific probes contain different fluorescent reporter dyes to differentiate the amplification of each allele.The aim of this study was to develop 2multiplex real-time TaqMan PCR systems that allow rapid and simultaneous detecting and serotyping of serovars 1,3,6,and 14of U.parvum .

Forty-eight strains of Ureaplasma were isolated from vaginal swabs of pregnant women kindly provided by Hubei Maternal and Child Health Hospital,Wuhan,China,and cultured using the urea –arginine LYO 2broth and Mycoplasma A7agar (Biomérieux China,Beijing,

China).

Diagnostic Microbiology and Infectious Disease 59(2007)109–

111

https://www.360docs.net/doc/0816408528.html,/locate/diagmicrobio

?Corresponding authors.Tel.:+86-27-6875-4627.E-mail addresses:wangyefu168@https://www.360docs.net/doc/0816408528.html, (Y .Wang),zhangchfwhu@https://www.360docs.net/doc/0816408528.html, (C.Zhang).

0732–8893/$-see front matter ?2007Elsevier Inc.All rights reserved.doi:10.1016/j.diagmicrobio.2007.04.014

These clinical isolates were serotyped by cloning and sequencing.The multiple-banded antigen(MBA)gene sequences of14U.urealyticum serovars were downloaded from the GenBank sequence database(http://www.ncbi. https://www.360docs.net/doc/0816408528.html,).Primers of all14serovars and TaqMan probes of4serovars of U.parvum were selected by comparing the MBA gene sequences using ClustalW (https://www.360docs.net/doc/0816408528.html,/clustalw/)and designed using the Primer Express 2.0software(Applied Biosystems,Foster City, CA).Because of the high A+T content of the target region of U.parvum,TaqMan minor groove binder(MGB)probe was chosen to enhance the melting temperature(T m)of the probe.The oligonucleotide sequences of primers for all14 serovars and TaqMan probes for serovars1,3,6,and14of U.parvum are shown in Table1.The primers were synthesized by Shanghai Invitrogen Biotechnology,Shang-hai,China.The TaqMan MGB probes were synthesized and modified by Shanghai Genecore Biotechnology, Shanghai,China.The lengths of amplicons of serovars2, 4,5,and7–13were261bps.The lengths of amplicons of serovars1,3,and14were216bps.The length of amplicons of serovar6was217bps.

DNA preparation and conventional PCR of48clinical isolates were performed as previously described(Kong et al.,1999a,1999b).To serotype48clinical isolates,the amplification products of the aforementioned conventional PCR were purified and ligated to plasmid vector pUCm-T (Shanghai Sangon Biological Engineering Technology and Service,Shanghai,China).The ligation products were transformed into Escherichia coli DH5α,and transformants

were screened by blue/white colony(Sambrook and

Russell,2001).Positive transformants were identified by

conventional PCR and digesting recombinant plasmid with

Eco RI and Bam HI,and then sequenced in2directions

using M13universal primer by Huanuo Biological Science

and Technology,Shanghai,China.The sequencing results

were queried against the GenBank database by using

BLAST and found to have a100%sequence similarity to

the respective GenBank sequence.Of the48clinical

isolates,6were identified as U.urealyticum biovar2and

42were identified as U.urealyticum biovar1(6as serovar

1,18as serovar3,14as serovar6,and4as serovar14).

PCR buffer(10×)without MgCl2,25mmol/L MgCl2,and

20mmol/L deoxynucleotide mixture(dATP,dTTP,dCTP,

and dGTP)were purchased from TaKaRa Biotechnology

Dalian,Liaoning,China.Multiplex real-time TaqMan PCR

mixture1/14contained 1.0×PCR buffer, 2.5mmol/L

MgCl2,0.20mmol/L deoxynucleotide mixture(dATP,

dTTP,dCTP,and dGTP),0.25μmol/L probe UPFP1,

0.30μmol/L probe UPFP14,0.45μmol/L primers UPF/

UPR,0.5U Hotstart Taq DNA Polymerase(Beijing

Tianwei,Beijing,China),and2μL of template in a single

PCR tube.Multiplex real-time TaqMan PCR mixture3/6

contained 1.0×PCR buffer, 3.0mmol/L MgCl2,

0.20mmol/L deoxynucleotide mixture(dATP,dTTP,

dCTP,and dGTP),0.35μmol/L probe UPFP3,0.30μmol/L probe UPFP6,0.45μmol/L primers UPF/UPR, 0.5U Hotstart Taq DNA Polymerase(Beijing Tianwei),

and2μL of template in a single PCR tube.Ultrapure

sterile water was added to bring the final volume to20μL.

Cycling conditions were as follows:95°C for5min,

followed by40cycles of94°C for15s and52°C for

60s.The iCycler iQ?multicolor real-time PCR detection

system(Bio-Rad,Hercules,CA)read each sample every

few seconds and computed a mean baseline reading for

early PCR cycles.A sample was considered positive when

its cycle threshold(C T)value was35or less.Forty-eight

clinical isolates and negative control(sterile water instead

of template)were tested in triplicate in multiplex real-time

TaqMan PCR.When the templates of serovars1/14were

added to the multiplex real-time TaqMan PCR system1/14

at the same time,the iCycler iQ?multicolor real-time

PCR detection system produced2fluorescence amplifica-

tion curves of FAM and HEX simultaneously.When only

the template of serovar1or14was added to the multiplex

real-time PCR system1/14,the iCycler iQ?multicolor

real-time PCR detection system produced only one

corresponding fluorescence amplification curve of FAM

or HEX.Six clinical isolates of U.urealyticum biovar2,

the templates of serovars3/6,and negative control showed

no fluorescence amplification curves after40cycles in the

multiplex real-time TaqMan PCR system1/14,suggesting

that the system1/14had a high degree of specificity.The

multiplex real-time PCR system3/6was the same as

system1/14.Thus,we can rapidly and simultaneously

Table1

The oligonucleotide sequences of primers for all14serovars of Ureaplasma

and TaqMan probes for serovars1,3,6,and14of U.parvum

Primer/

probe

Sequence(5′→3′)Size(nt)T m(°C)

UP primers a

UP F b GTATTTGCAATCTTTATATGTTTTCG2654

UP R c TCCAGCTCCAACTAAGGTAAC2154

UP TaqMan probes d

UP FP1e TGTAAGATTGCTAAATC1763

UP FP3f TGTAAGATTACCAAATC1763

UP FP6g AGTGTTCATATTTTTTACTAG2164

UP FP14h TCTTAGCTATGACATTAG1864

UU Primers i

UU F b GTATTTGCAATCTTTATATGTTTTCG2654

UU R c CCCTGCTCCCACTAAAGTTAC2155

UP FP1/6were labeled with the reporter dye6-FAM at the5′end and MGB

at the3′end.UP FP3/14were labeled with the reporter dye HEX at the5′

end and MGB at the3′end.

a Common primers of U.parvum.

b Forward primer.

c Reverse primer.

d TaqMan prob

e o

f U.parvum.

e TaqMan probe o

f serovar1of U.parvum.

f TaqMan probe of serovar3of U.parvum.

g TaqMan probe of serovar6of U.parvum.

h TaqMan probe of serovar14of U.parvum.

i Common primers of U.urealyticum.

110X.Cao et al./Diagnostic Microbiology and Infectious Disease59(2007)109–111

detect and serotype the samples of serovars1,3,6,and14 of U.parvum by the aforementioned2multiplex real-time TaqMan PCR systems.

The2multiplex real-time TaqMan PCR systems allow for rapid and simultaneous detecting and serotyping of U.parvum,which offers significant advantages over con-ventional serotyping methods(Kong et al.,1999a,1999b). Theoretically,multicolor detection system can monitor4 amplifications in1well simultaneously.However,the competition of different serovar templates may affect the amplification efficiency of each serovar,the interaction of different serovar-specific probes may affect the detection efficiency of each serovar,and the sensitivity of multiplex real-time TaqMan PCR may be lower than that of single real-time TaqMan PCR.Considering these inevitable competition and interaction,we give up adding4serovar-specific probes into1reaction system at1time and select the format of2 multiplex real-time TaqMan PCR systems eclectically.In the future,rapid and simultaneous detecting and serotyping of the samples of serovars1,3,6,and14of U.parvum by the aforementioned2multiplex real-time TaqMan PCR systems will assist in the study of the pathogenesis and epidemiology of Ureaplasma infections.

Acknowledgment

This work was supported by the Bureau of Science and Technology of Wuhan(grant20066002053),Hubei,PR China.The authors thank Hubei Maternal and Child Health Hospital,Wuhan,China,for providing clinical samples.The authors also thank Young Kung(Ontario,Canada)for performing a language check of the article.

References

Goldenberg RL,Thompson C(2003)The infectious origin of stillbirth.

Am J Obstet Gynecol189:861–873.

Horner P,Thomas B,Gilroy CB,Egger M,Taylor-Robinson D(2001)Role of Mycoplasma genitalium and Ureaplasma urealyticum in acute and chronic nongonococcal urethritis.Clin Infect Dis32:995–1003.

Kong F,Zhu X,Wang W,Zhou X,Gordon S,Gilbert GL(1999a) Comparative analysis and serovar-specific identification of multiple-banded antigen genes of Ureaplasma urealyticum biovar1.J Clin Microbiol37:538–543.

Kong F,James G,Ma Z,Gordon S,Bin W,Gilbert GL(1999b)Phylogenetic analysis of Ureaplasma urealyticum—support for the establishment of a new species,Ureaplasma parvum.Int J Syst Bacteriol49:1879–1889. Kong F,Ma Z,James G,Gordon S,Gilbert GL(2000)Species identification and subtyping of Ureaplasma parvum and Ureaplasma urealyticum using PCR-based assays.J Clin Microbiol38:1175–1179. Sambrook J,Russell DW(2001)Molecular Cloning:A Laboratory Manual.

3rd ed.New York(USA):Cold Spring Harbor Laboratory Press, pp.1–146.

Sevall JS(2001)Rapid allelic discrimination from real-time DNA amplification.Methods25:452–455.

Yi J,Yoon BH,Kim EC(2005)Detection and biovar discrimination of Ureaplasma urealyticum by real-time PCR.Mol Cell Probes 19:255–260.

Yoon BH,Romero R,Lim JH(2003)The clinical significance of detecting Ureaplasma urealyticum by the polymerase chain reaction in the amniotic fluid of patients with preterm labor.Am J Obstet Gynecol 189:919–924.

Zheng X,Watson HL,Waites KB,Cassell GH(1992)Serotype diversity and antigen variation among invasive isolates of Ureaplasma urealyticum from neonates.Infect Immun60:3472–3474.

111

X.Cao et al./Diagnostic Microbiology and Infectious Disease59(2007)109–111