Detection of Escherichia coli O157 H7 virulence genes in isolates from

Detection of Escherichia coli O157:H7virulence genes in isolates from beef,pork,water,human and animal species in the northwest province,South Africa:public health implicationsCollins Njie Ateba *,Moses Mbewe 1Dale Beighle Centre for Animal Health Studies,School of Agricultural Sciences,North-West University e Mafikeng Campus,P .Bag X2046,Mmabatho 2735,South AfricaReceived 6October 2010;accepted 8November 2010Available online 25January 2011AbstractThe aim of theandidentify Escherichia coliO157:H7from pigs,cattle,andwatersamplestheir by A total of 220samples coli O157:H7were for the by PCR and 130isolates was pigs and pork 88(67.7%)than in cattle water 3(2.3%)or was more frequently isolated from faecal (16.9%e 43.1%)than from meat samples (10.8%e 24.6%).A large proportion d 73isolates possessed the hlyA gene,while 48(36.9%)harboured the eaeA gene.Although there were no major differences in the number of isolates harbouring the stx 1and stx 2genes,respectively,only a small proportion 13(10%)harboured both shiga toxin genes.Despite this,the proportion of isolates that possessed the stx 129(22.3%)was higher the stx 2gene.None of the E.coli O157:H7isolates harboured all four shiga-toxin producing E.coli (STEC)virulence genes When comparing the proportion of isolates obtained from the different sample sources and/or stations,significant positive between isolates from Mafikeng and Lichtenburg (r ¼0.981,p <0.05)and those from Mafikeng and Rustenburg (r ¼0.991,p <0.05).These results therefore indicate that meat and faeces samples obtained from major cities in the northwest province were contaminated with E.coli O157:H7.We suggest that there is a need for improving the sanitary conditions of farms,abattoirs and butcher shops.This could reduce transmission of E.coli O157:H7to humans.Ó2011Institut Pasteur.Published by Elsevier Masson SAS.All rights reserved.Keywords:Escherichia coli O157:H7;rfb O157;fliC H7;Cattle;Pigs;Humans1.IntroductionShiga-toxin-producing Escherichia coli are food-borne pathogens that cause diseases in humans (Bell,2000;Leelaporn et al.,2003;Nunes et al.,2003;Maruzumi et al.,2005;Sugiyama et al.,2005).Serotype O157:H7,in particular,has attracted significant attention due to its ability to cause disease even when only a few bacterial cells are present in food and/or water(Armstrong et al.,1996;Buchanan and Doyle,1997).Diseases caused by E.coli O157:H7in humans include watery and/or bloody diarrhoea,haemorrhagic colitis (HC),haemolytic urae-mic syndrome (HUS)and thrombotic thrombocytopenic purpura (TTP)(Griffin and Tauxe,1991;Armstrong et al.,1996;Weir,2000;Sugiyama et al.,2005).These infections are usually severe in young children,elderly subjects and immunocom-promised individuals (Riley et al.,1983;Duffy et al.,2006;Razzaq,2006;Walch et al.,2006).The ability of E.coli O157:H7to cause disease is associated with production of potent toxins.Shiga toxin genes designatedstx 1and stx 2are the major virulence factors (Pie´rard et al.,1997;Law,2000).Alongside shiga toxins,other variants of stx 2,eaeA ,*Corresponding author.Tel.:þ27183892247;fax:þ27183892134.E-mail addresses:atebacollins1@ (C.N.Ateba),moses.mbewe@nwu.ac.za (M.Mbewe).1Tel.:þ27183892702,þ27728657464(mobile);fax:þ27183892748.Research in Microbiology 162(2011)240e 248/locate/resmic0923-2508/$-see front matter Ó2011Institut Pasteur.Published by Elsevier Masson SAS.All rights reserved.doi:10.1016/j.resmic.2010.11.008本页已使用福昕阅读器进行编辑。

福昕软件（Ｃ）２００５－２０１０，版权所有，仅供试用。

and hlyA genes have been found to play roles in the development of disease(Jerse et al.,1990;Pie´rard et al.,1997;Law,2000).Cattle represent the principal reservoir of E.coli O157:H7 (Langreid et al.,1999;Cobbold and Desmarchelier,2000). However,the pathogen has also been isolated from the faeces of other species of domestic animals that include pigs,goats,cats, deer and sheep(Heuvelink et al.,1996;Leung et al.,2001; Mu¨ller et al.,2002;Botteldoorn et al.,2003;Rey et al.,2003; Tutenel et al.,2003;Nagano et al.,2004;Ju-Yeon et al.,2006; Ateba et al.,2008).Failure to implement proper farm manage-ment techniques and/or strict sanitary conditions during the production process,handling and marketing of meat usually facilitates transfer of E.coli O157:H7to the meat and its asso-ciated food products(Samadpour et al.,1994;Bouvet et al., 2001;Radu et al.,2001;Botteldoorn et al.,2003;Tutenel et al.,2003).Food products such as chicken,lamb,pork,beef, mince,vegetables and water contaminated with E.coli O157:H7 are the principal sources of infection(Chapman et al.,1993; Samadpour et al.,1994;Richert et al.,2000;LeJeune et al., 2001;Guan and Levin,2002).It is therefore important to cook these food products properly before they are consumed.Although we reported the prevalence of this pathogen in cattle and pigs in some areas of the northwest province of South Africa(Ateba et al.,2008),the prevalence of E.coli O157:H7in food products such as pork and beef in South Africa,and the northwest province in particular,is unknown. Given the increasing demand for beef and pork in South Africa,such an investigation is needed.In the present study, we expanded our investigation with the aim of reporting the occurrence of E.coli O157:H7in cattle,pigs,humans,water, pork and beef samples in some major cities in the northwest province of South Africa.This was designed to determine the level of contamination of meat at sale points,which does not exclude contamination at the abattoirs.The objectives of the study were to isolate and identify E.coli O157:H7from humans,animals,water and some food products purchased at supermarkets in major cities in the northwestern province of South Africa and to characterise isolates for the presence of shiga toxin virulence genes using PCR.2.Materials and methods2.1.Sample collectionOne-hundred faecal samples were collected from cattle,pigs and humans,while40water samples each were collected from taps and river catchments in the northwestern province of South Africa.Meat samples consisted of40pork and40beef samples purchased at supermarkets in major cities in the province.The meat samples were placed in sterile plastic bags and labelled based on sample type and area of collection.Human faecal samples were collected from20patients presenting at the Mafikeng provincial hospital for diarrhoea.The hospital does not perform routine screening for E.coli O157:H7and thus,the impact of this pathogen in diarrhoeal cases in the area is unknown.The isolation of E.coli O157:H7from human stool samples was performed at the microbiology laboratory of Mafikeng Provincial Hospital.Samples were handled with care and all ethical procedures were enforced during isolation of E. coli O157:H7.They were obtained without any indication of patient identity,used only for bacterial isolation and properly disposed of by the laboratory staff of the hospital immediately after analysis.Animal samples were collected directly from the rectum of animals using sterile arm-length gloves and were placed in sterile sample collection bottles.Water samples were collected in100ml collection bottles.Meat,faeces and water samples were immediately transferred on ice to the laboratory for analysis.Upon arrival in the laboratory,all samples were analysed immediately or held at4 C for not more than48h before analysis.Table1A and B indicate the numbers of different samples collected from the stations sampled.2.2.Isolation of E.coli O157:H72.2.1.Human stool and animal faecal samplesTwo grams of faecal samples were dissolved in5ml of modified triptycase soy broth(Merck Diagnostics e UK) supplemented with novobiocin(2m g/ml)and cefixime(50ng/ ml).The broth was incubated at37 C for24h(Meichtri et al., 2004).Tenfold serial dilutions of pre-enriched samples were performed using2%peptone water.Aliquots of100m l from each dilution was plated onto sorbitol e MacConkey agar (SMAC)supplemented with cefixime(50ng/ml)and Table1Area of collection,source,nature and number of samples collected during the study. Sample source Sampling area Nature of sample Number ofsamples Pigs Koster Faecal sample8Lichtenburg Faecal sample8Mafikeng Faecal sample8Rustenburg Faecal sample8Zeerust Faecal sample8Pigs Koster Pork8Lichtenburg Pork8Mafikeng Pork8Rustenburg Pork8Zeerust Pork8 Bovine Koster Faecal sample8Lichtenburg Faecal sample8Mafikeng Faecal sample8Rustenburg Faecal sample8Zeerust Faecal sample8 Bovine Koster Beef8Lichtenburg Beef8Mafikeng Beef8Rustenburg Beef8Zeerust Beef8Water Koster Water8Lichtenburg Water8Mafikeng Water8Rustenburg Water8Zeerust Water8 Human Mafikeng Provincial5HospitalFaecal sample20241C.N.Ateba,M.Mbewe/Research in Microbiology162(2011)240e248potassium tellurite(25mg/ml).Plates were incubated at37 C for24h(Meichtri et al.,2004).2.2.2.Meat samplesFor isolation of E.coli O157:H72g of beef or pork was washed in5ml of modified triptycase soy broth(Merck Diag-nostics,U.K),supplemented with novobiocin(2m g/ml)and cefixime(50ng/ml).The broth was incubated at37 C for24h (Meichtri et al.,2004).Tenfold serial dilutions of the pre-enriched samples were made using2%peptone water.Aliquots of100m l from each dilution were plated onto sorbitol e MacConkey agar (SMAC)supplemented with cefixime(50ng/ml)and potassium tellurite(25mg/ml).The plates were incubated at37 C for24h (Meichtri et al.,2004).2.2.3.Water samplesFive hundred millilitres of water were collected from each source per collection.Aliquots of100ml from each of the samples wasfiltered through0.45m m Gridfilter-units(Type HA)using a Gelman Little Gaint pressure/vacuum pump machine(model13156,GelmanSciences,MI,USA).The filters were placed on sorbitol e MacConkey agar(SMAC) supplemented with cefixime(50ng/ml)and potassium tellurite (25mg/ml).The plates were incubated at37 C for24h (Mu¨ller et al.,2001).Presumptive E.coli O157:H7colonies were colourless on CT e sorbitol e MacConkey agar and56of these from each sample were subcultured onto CT e sorbitol e MacConkey agar. The plates were incubated at37 C for24h(Meichtri et al., 2004).The isolates were cultured on nutrient agar and plates were incubated at37 C for24h.The plates were stored at room temperature until the isolates were identified and char-acterized for the presence of STEC virulence genes by PCR.2.3.E.coli control strainsE.coli O157:H7(ATCC43889)that possessed the stx2, stx1,eae and hlyA genes was used as positive controls,while E.coli O157:H7(NCTC12900)that is a non-pathogenic strain and does not harbour any of the targeted genes was used asa negative control.2.4.Extraction of genomic DNAGenomic DNA was extracted from all5600presumptive E.coli O157:H7isolates using the alkaline lysis method (Sambrook et al.,1989).2.5.Quantification of genomic DNA extractedDNA extracted from E.coli O157:H7isolates and control strains was quantified using a UV Visible Spectrophotometer (model S-22,Boeco,Germany).A one-in-ten dilution of the DNA extracted was prepared in glass cuvettes(Sigma)using sterile distilled nuclease-free water.Sterile distilled nuclease water was used as a blank and the optical density(OD)of the diluted samples was determined at wavelengths of260nm and 280nm(Sambrook et al.,1989).OD at260nm was used to determine the concentration of DNA in the solution.The concentration of DNA was determined using the standard that an OD of1corresponds to approximately50m g/ml of double-stranded DNA.Furthermore,the ratio of the OD at260nm versus that at280nm was used to estimate the purity of the DNA extracted.Readings ranged from 1.8to 2.0,which indicated that the DNA was relatively pure.2.6.Identification of suspected E.coli O157:H7isolates by PCRBacterial16S rRNA gene fragments were amplified as an internal control for all isolates(Muyzer et al.,1995).The identities of the suspected E.coli O157:H7isolates were confirmed through amplification of rfbO157gene fragments (Morin et al.,2004)and E.coli H7fliC H7gene fragments (Reischl et al.,2002),respectively.PCRs were performed using oligonucleotide primer combinations and cycling conditions that appear in Table2.Amplifications were per-formed using a Peltier Thermal Cycler(model-PTC-220 DYADÔDNA ENGINE).The reactions were prepared in 25m l volumes that constituted1m g/m l of the template DNA, 50pmol of each oligonucleotide primer set,1X PCR master mix,1U Taq DNA polymerase and RNase free distilled water. All PCR reagents used were Fermentas,USA products supplied by Inqaba Biotec Ltd,Sunnyside South Africa. Amplification conditions for16S rRNA gene fragments, rfb O157and thefliC H7gene fragments,are shown in Table2. All PCR products were stored at4 C.2.7.Detection of E.coli O157:H7virulence genes byPCRAll E.coli O157:H7isolates were screened for the presence of STEC virulence genes that included stx1,stx2,eae and hlyA. The reactions were prepared in25m l volumes and amplifi-cations were performed using a Peltier thermal cycler(model-PTC-220DYADÔDNA ENGINE).PCR products were stored at4 C.2.8.Electrophoresis of PCR productsPCR products were separated by electrophoresis on1% (w/v)agarose gel.Electrophoresis was conducted in a hori-zontal Pharmacia biotech equipment system(model Hoefer HE99X;Amersham Pharmacia biotech,Sweden)for5h at 60V using1x TAE buffer(40mM Tris,1mM EDTA and 20mM glacial acetic acid,pH8.0).Each gel contained a100bp DNA molecular weight marker(Fermentas,USA). The gels were stained in ethidium bromide(0.1m g/ml)for 15min and amplicons were visualised under UV light (Sambrook et al.,1989).A Gene Genius Bio imaging system (Syngene,Synoptics;UK)was used to capture the image using GeneSnap(version 6.00.22)software.Images were analysed using GeneTools(version 3.07.01)software242 C.N.Ateba,M.Mbewe/Research in Microbiology162(2011)240e248(Syngene,Synoptics;UK)to determine the relative sizes of the amplicons.2.9.Statistical analysisStatistical analysis was done using SPSS software (version 14.0).Pearson’s correlation product of the moment was used to determine the correlation between E.coli O157:H7isolated from the different sample sources and/or stations.The two-tailed test of significance (p <0.05)was used.3.Results and discussion3.1.Detection of E.coli O157:H7isolates from animal faecal samples,human stool samples,beef,pork and water samplesA total of 220samples were collected from two animal species that included cattle and pigs,humans,meat (beef and pork)and water during the study.These samples were ana-lysed for the presence of E.coli O157:H7using modifiedTable 2Oligonucleotide primers used for amplification of the various targeted genes in E.coli O157:H7and the different cycling conditions utilized.Primer Sequence (50e 30)Targeted gene Amplicon size (bp)References PCR cycling conditions GM5F TACGGGAGGCAGCAG16S ribosomal genes550Muyzer et al.,199535x a95 C for 30s 62C for 1min 72 C for 1min 907R CCGTCAATTCCTTTGAGTTT RfbE F GCGCGAATTCGTGCTTTTGA TATTTTTCCGAGTACATTGG rfbE O157239Morin et al.,200445x b94 C for 30s 60 C for 90s 72 Cfor 90s RfbE R GCGCGAATTCTTTATATCAC GAAAACGTGAAATTGCTGAT FliCH7F GCTGCAACGGTAAGTGAT fliC H7984Reischl et al.,200245x b94 C for 30s 60C for 90s 72 C for 90s FliCH7R GGCAGCAAGCGGGTTGGT Eae F GACCCGGCACAAGCATAAGC eae 384Paton and Paton,199835x c94 C for 1min 59 C for 1min 72 C for 1min Eae R CCACCTGCAGCAACAAGAGG HlyAF GCATCATCAAGCGTACGTTCC hlyA 534Paton and Paton,199835x c94 C for 1min 59 C for 1min 72 C for 1min HlyAR AATGAGCCAAGCTGGTTAAGCT Stx 1F ATAAATCGCCATTCGTTGACTAC A subunit of stx 1180Paton and Paton,199840x c94 C for 1min 63 C for 1min 72 C for 1min Stx 1R AGAACGCCCACTGAGATCATC Stx 2F GGCACTGTCTGAAACTGCTCC A subunit of stx 2255Paton and Paton,199840x c94 C for 1min 63 C for 1min 72Cfor1minStx 2RTCGCCAGTTATCTGACATTCTa,b,cInitial denaturing steps of (95 C for 10min),respectively,and final strand extension steps of (72 C for 10min).Fig.1.Agarose gel (1%)of 16S rRNA gene fragments that were amplified from DNA extracted from the E .coli O157:H7isolated from samples obtained from the different sources and E.coli control ne 1¼DNA marker (100base pairs);Lanes 2e 10¼16S rRNA fragments amplified from DNA of E .coli O157:H7isolates obtained from cattle,pigs,beef,pork,water and human stool samples;Lanes 11and 12¼16S rRNA fragments amplified from DNA of obtained from E .coli O157:H7(ATCC 43889)and E .coli O157:H7(NCTC 2900),respectively.243C.N.Ateba,M.Mbewe /Research in Microbiology 162(2011)240e 248selective media.Only those isolates that fermented sorbitol (colourless on CT e SMAC agar)were used.A total of 12320presumptive isolates were obtained.The identities of these isolates were later investigated based on the presence of rfb O157and the fliC H7gene fragments using PCR.The 16S rRNA gene fragments are shown in Fig.1,while the rfb O157gene fragments that were amplified are depicted in Fig.2.The results in Table 3indicate the number of E.coli O157:H7isolated from faeces and meat samples of the different species and water samples investigated.A total of 130(1.1%)E.coli O157:H7isolates were positively identified by PCR in this study.A larger proportion d 88(67.7%)d of E.coli O157:H7was isolated from pigs than from cattle (36(27.7%)),river catchments (3(2.3%)),tap water (2(1.5%))or humanstool samples (1(0.77%)).Generally,the proportion of E.coli O157:H7isolated was higher in faeces (16.9%e 43.1%,respectively)than in meat samples (10.8%e 24.6%,respec-tively)for both animal species sampled.The proportion of E.coli O157:H7isolated was higher in both faeces samples of pig (23.2%e 35.7%,respectively)and pork samples (28.1%e 37.5%,respectively)obtained from Mafikeng and Rustenburg when compared to the other stations and/or species sampled.Despite the fact that E.coli O157:H7was not isolated from beef samples obtained from Zeerust,the pathogen was identified in both faeces samples of cattle and in beef samples obtained from all other stations sampled.There was no major difference in the number of isolates obtained from either the cattle faeces or beef samples investigated.We therefore suggest that isolates in the GIT of cattle are transmitted via contamination during the production process.E.coli O157:H7was not isolated from water samples obtained from a large proportion of the stations (Table 3).Despite this,the pathogen was identified in water used for domestic purposes by residents of an informal settle-ment in Koster.This was a cause for concern.3.2.Molecular characterisation of E.coli O157:H7isolated from animal faecal samples,human stool samples,beef,pork and water samplesA total of 130E.coli O157:H7isolates obtained in the study were screened for the presence of STEC virulence genes by PCR.The proportions of the various genes detected in E.coli O157:H7isolated from the different species and/or sources are shown in Table 4.The isolates were further ana-lysed for combinations of the various virulence genes detected per isolate.A summary of data indicating the different geno-types obtained for isolates from the different species and/or sources is also shown in Table 4.Eight major genotypes were identified.As shown in Table 4,73(56.2%)of the isolates investigated possessed the hlyA gene fragment with or without a combination of the other genes tested;53of these isolates (40.8%)harboured the hlyA gene alone.This gene fragment was more prevalent in isolates obtained from pig faeces and pork (49,or 37.7%)than from cattle faeces andbeefFig.2.Agarose gel (1%)of 16S rRNA gene fragments that were amplified from DNA extracted from the E .coli O157:H7isolated from samples obtained from the different sources and E.coli control ne 1¼DNA marker (100base pair);Lane 2¼rfb O157gene fragments amplified from E .coli O157:H7(ATCC 43889)control strain;Lanes 3e 4:rfb O157gene fragments amplified from E.coli O157:H7isolated.Table 3Number of E.coli O157:H7identified from samples obtained from the different species and/or sources through PCR amplification of the rfb O157and fliC H7gene fragments.SourceHumans Pigs CattleWaterTotalFaecesFaeces Pork Faeces Beef Taps Rivercatchment Mafikeng 12012760046Lichtenburg NT 117640028Koster NT 83212319Rustenburg NT 139530030Zeerust NT 4120007Total15632221423130NT ¼Not tested.Table 4Characterization of E.coli O157:H7for the presence of shiga toxin virulence genes using PCR.SpeciesNature of sampleNo.and percentage of E.coli O157:H7that possessed the virulence genes amplified stx 1stx 2eaeA hlyA PigsFaeces 14132231Pork491218Cattle Faeces105611Beef1359Water Tap0002River catchments0021Humans Faeces0111Total number of different genes amplified29314873244 C.N.Ateba,M.Mbewe /Research in Microbiology 162(2011)240e 248(21,or16.2%),water (5,or 3.8%)or human stool samples (1,or 0.8%).The eaeA gene was also identified in 48(36.9%)of the isolates tested.Generally,the prevalence of this gene fragment was higher in isolates from pig faeces and pork (34,or 26.2%)than in those from cattle faeces and beef samples (11,or 8.5%).Although there was no major difference in the number of isolates obtained in this study that possessed the stx 1and stx 2genes respectively,only 13of them (10%)harboured both shiga toxin genes.Despite this,the number of isolates that possessed the stx 1gene,i.e.29(22.3%),was higher than those with the stx 2gene (Table 4).None of the E.coli O157:H7isolates obtained harboured all four STEC virulence genes investigated.Only 12of them (9.2%)possessed the stx 2gene in combination with the two accessory virulence gene deter-minants (eaeA and hlyA )(Table 5).4.DiscussionThe primary objective of this study was to isolate E.coli O157:H7from pig and cattle faeces samples,pork,beef,water and human stool samples.An investigation of the extent to which isolates from pigs and cattle may contaminate food products (pork and beef),and water cannot be overemphasized.Microbes in the GIT tract of animals can contaminate the environment used for slaughtering,machines used for cutting and the personnel.These pathogens can be transferred to meat if proper hygiene is not implemented,especially at the sale points (Bouvet et al.,2001;Tutenel et al.,2003;Yilmaz et al.,2006).Meat contaminated with E.coli O157:H7has been identified as a potential source of transmission of these pathogens in humans (Tsuji et al.,2002;Maruzumi et al.,2005).The demand for beef and pork in South Africa is high.Despite the fact that we had reported that the prevalence of E.coli O157in pigs was higher (44.2%e 50%)than in cattle (5.4%e 20.0%)and humans (7.5%)(Ateba et al.,2008),an investigation aimed at determining the proportion of this pathogen and its virulence determinants in pork and beef may serve as a means of investigating the degree to which public health regulations are implemented in the meat production process in the northwest province of South Africa.In the present study,E.coli O157:H7was successfully iso-lated from faeces,meat samples,water and human stoolsamples tested.Similar to our previous observation (Ateba et al.,2008),in the present study,the proportion of E.coli O157:H7isolated was higher in pigs than in cattle,water or human stool samples.Moreover,the prevalence of this path-ogen was higher in pork than in beef samples.Similar studies have also been conducted to determine the prevalence of this pathogen in both these animal species,carcasses in abattoirs and their corresponding food products worldwide (Bouvet et al.,2001;Guyon et al.,2001;Johnsen et al.,2001;Botteldoorn et al.,2003;Mu ¨ller et al.,2003;Tutenel et al.,2003;Jo et al.,2004;Ellingson et al.,2005;Villani et al.,2005;Yilmaz et al.,2006;Lim et al.,2007;Mu ¨ffling et al.,2007).Although the prevalence rates obtained in these studies varied,it was reported that the proportion of E.coli O157:H7was often higher in pigs and/or pork than cattle and/or beef samples (Lim et al.,2007).Similar observations were seen in the present study.However,it had also been reported that the proportion of isolates obtained from faeces samples of cattle and beef samples was higher than those obtained from faeces samples of pigs and pork samples (Jo et al.,2004).Moreover,in the previous study,this pathogen was not isolated from faeces samples from chicken or chicken meat samples.Based on results presented herein,we suggest that the prevalence of E.coli O157:H7in animals and meat sold in supermarkets largely depends on hygiene conditions on the farms,that of equipment used in abattoirs,the surrounding environment and among the personnel.This may account for the high contamination with E.coli O157:H7identified in meat samples obtained from Mafikeng and Rustenburg.These cities are more heavily populated,and sales attendants in some supermarkets usually have to serve more than one person at a given time.This can result in poor hygiene and handling practices.It is thus important to cook meat products properly before they are consumed so as to limit human infection.Moreover,implementation of such control measures at the farms,in the abattoirs or when cooking meat may reduce food-borne infections in humans.A further objective of the study was to characterise E .coli O157:H7isolated from the different species and/or sources for the presence of STEC virulence gene determinants using PCR analysis.A total of 130isolates and control strains wereTable 5Proportion of eight different gene combinations (genotypes)identified in E.coli O157:H7isolated.The notations G1to G8indicate gene combinations of these eight genotypes.Gene combinations for E.coli O157:H7isolatedProportion of E.coli O157:H7isolates with the different gene combinations per specie and/or sample source.HumansPigs Cattle Water Total (%)rfbE O157fliC H7stx 1stx 2eaeA hlyA Faeces Faeces Pork Faeces Beef Tap River catchments þþG1ÀÀþþ06200008(6.2%)þþG2þÀÀÀ081700016(12.3)þþG3Àþþþ153210012(9.2%)þþG4ÀÀÀþ020********(40.8%)þþG5ÀÀþÀ097130222(16.9%)þþG6þþÀÀ04300007(5.4%)þþG7þþþÀ02031006(4.6%)þþG8ÀþÀÀ2316(4.6%)þ¼Gene present,À¼gene absent,G1e G8¼eight different genotypes identified in the study.245C.N.Ateba,M.Mbewe /Research in Microbiology 162(2011)240e 248analysed.Contrary to our previous report in which none of the isolates from pigs,cattle or humans possessed the shiga toxin genes(Ateba and Bezuidenhout,2008),these gene fragments were detected in13(10%)of the isolates tested in the present study.The stx genes are known to be the primary virulence factors of E.coli O157:H7,but the stx2gene is usually more prevalent in E.coli O157:H7isolates(Paton and Paton,1998; Johnsen et al.,2001;Villani et al.,2005).However,in the present study,a larger proportion of the isolates d16 (12.3%)d possessed the stx1gene compared to stx2.Previous reports indicated that the stx2gene rather than stx1was more strongly associated with disease in humans(Bidet et al.,2005). Similarly,in our study,the stx2gene was detected in the isolate obtained from an individual suffering from diarrhoea.The high prevalence of hlyA and eae genes in a large proportion of E.coli O157:H7isolates from pigs without diarrhoea was cause for concern.hlyA is a plasmid-encoded gene(Schmidt et al.,1999)that confers haemolytic activity upon the host bacteria on5%sheep blood agar(Beutin et al., 1998).This may explain its high prevalence in the bacterial populations analysed.The eae gene encodes for intimin that facilitates intimate attachment of E.coli O157:H7to the host cell by producing attaching and effacing intestinal lesions (Knutton et al.,1989).Generally,this gene was more prevalent in isolates from non-diarrhoeal pigs and pork than cattle and beef,water or humans.Although stx genes are considered the primary virulence genes,there exists co-association with the eae gene(Johnsen et al.,2001;Omisakin et al.,2003).Similar observations were obtained in the present study. E.coli O157:H7isolated from an individual with diarrhoea possessed stx2together with eae and hlyA genes.Although the eae gene is usually present in E.coli O157:H7isolated from diseased cases,its role in the pathogenesis of human disease requires further elucidation(Beutin et al.,2004).In a previous study, we identified an E.coli O157:H7isolate from a human subject suffering from diarrhoea that did not harbour any of the stx genes(Ateba and Bezuidenhout,2008).We therefore suggest that the ability of an E.coli O157:H7isolate to cause disease in humans depends on its ability to produce different virulence gene determinants,and on a number of physiological factors in the host.In the present study,eae and hlyA genes were more prev-alent in E.coli O157:H7isolated from non-diarrhoeal pigs than cattle,and more prevalent in pork than in beef or human samples.Similar observations had previously been reported (Frydendahl,2002;Hornitzky et al.,2002;Ateba and Bezuidenhout,2008).Based on data obtained from our previous study coupled with those presented herein,it is our view that pigs rather than cattle are easily colonised by E.coli O157:H7in the study area and are a potential host for this pathogen in the northwest province of South Africa.Thus, pork rather than beef can potentially transmit E.coli O157:H7 to humans.This indicates the need to implement proper hygiene on farms and meat processing plants.E.coli O157:H7that possess different gene combinations have been isolated from food and environmental sources (Galland et al.,2001)worldwide.However,in the present study,we identified isolates with eight different genotypes. None of the isolates possessed all the virulence genes tested, and only a few isolates possessed up to three of the genes tested.Despite this,detection of the stx,eaeA and hlyA gene fragments in an isolate obtained from human stool samples indicated that these genes facilitate the development of human disease.However,E.coli O157:H7isolates that do not possess the shiga toxin genes,but possess one or more of the accessory virulence genes,have been found to cause disease in humans (Ateba and Bezuidenhout,2008).This indicates the need to limit the prevalence of this pathogen in animals and food products and to develop sensitive methods for detecting E.coli O157:H7in food.This will ensure food safety and proper clinical treatment of its associated infections.In conclusion,detection of E.coli O157:H7from beef, pork,water and human stool samples in the northwest prov-ince of South Africa not only indicates that there exists contamination of meat bought at sale points but it also raises the question of hygiene practices both on farms and at abat-toirs.Moreover,the presence of this pathogen,even at low levels,is highly significant,since it can survive unfavourable conditions in frozen and refrigerated food products.It is important that measures be implemented to prevent contact between the hides and intestinal contents of animals and the carcass.This may reduce transmission of these pathogens to meat and limit human infection.We recommend that humans who suffer from diarrhoea in the study area should report cases to the hospital so that the actual incidence of infections caused by E.coli O157:H7is known.AcknowledgementsThe authors would like to thank the North-West University and,in particular,the Faculty of Agriculture,Science and Technology for funding this project.We also thank Dr.E. Mu¨ller,previously with the Department of Medical Virology, University of Pretoria e South Africa,for providing control strains used in this study.The assistance received from Ms.N.D.Lesaoana and Mr.Beleng is hereby acknowledged. ReferencesArmstrong,G.L.,Hollingsworth,J.,Morris Jr.,J.M.,1996.Emerging food-borne pathogens:Escherichia coli O157:H7as a model of entry of a new pathogen into the food supply of the developed world.Epidemiol.Rev.18, 29e51.Ateba, C.N.,Mbewe,M.,Bezuidenhout, C.C.,2008.The prevalence of Escherichia coli O157strains in cattle,pigs and humans in the North-West Province,South Africa.SAJS104,7e8.Ateba,C.N.,Bezuidenhout,C.C.,2008.Characterisation of Escherichia coli O157strains from humans,cattle and pigs in the Northwest Province, South Africa.Int.J.Food Microbiol.128,181e188.Bell,C.,2000.Approach to the control of entero-haemorrhagic Escherichia coli(EHEC).Int.J.Food Microbiol.78,197e216.Beutin,L.,Geier, D.,Zimmermann,S.,Aleksic,S.,Gillespie,H.A., Whittam,T.S.,1998.Epidemiological relatedness and clonal types of natural populations of Escherichia coli strains producing shiga-toxins in separate populations of cattle and sheep.Appl.Environ.Microbiol.63, 2175e2180.246 C.N.Ateba,M.Mbewe/Research in Microbiology162(2011)240e248。